Construct: shRNA TRCN0000072206

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_276s1c1
DNA Barcode:
GTGGGAGCGCGTGATGAACTT
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 276 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 276 1.650 N/A
2 human 146754 DNAH2 dynein, axonemal, heavy cha... NM_020877.3 89% 5UTR 842 N/A N/A
3 human 11313 LYPLA2 lysophospholipase II XM_005245728.3 89% 5UTR 202 N/A N/A
4 mouse 94230 Cpsf1 cleavage and polyadenylatio... NM_001164173.1 89% CDS 2251 N/A N/A
5 mouse 94230 Cpsf1 cleavage and polyadenylatio... NM_053193.2 89% CDS 2251 N/A N/A
6 mouse 94230 Cpsf1 cleavage and polyadenylatio... XM_006521602.1 89% CDS 2073 N/A N/A
7 mouse 94230 Cpsf1 cleavage and polyadenylatio... XM_006521603.1 89% CDS 2073 N/A N/A
8 mouse 94230 Cpsf1 cleavage and polyadenylatio... XM_011245781.1 89% CDS 2273 N/A N/A
9 mouse 20377 Sfrp1 secreted frizzled-related p... NM_013834.3 85% 3UTR 1272 N/A N/A
10 mouse 20377 Sfrp1 secreted frizzled-related p... XM_011242128.1 85% 3UTR 1327 N/A N/A
11 mouse 102635272 Gm32655 predicted gene, 32655 XR_385568.2 85% 3UTR 113 N/A N/A
12 mouse 102635272 Gm32655 predicted gene, 32655 XR_385569.2 85% 3UTR 109 N/A N/A
13 mouse 102635272 Gm32655 predicted gene, 32655 XR_397442.2 85% 3UTR 112 N/A N/A
14 mouse 102635272 Gm32655 predicted gene, 32655 XR_397443.2 85% 3UTR 108 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTGGGAGCGCGTGATGAACTT
Hairpin Sequence:
5'-CCGG-GTGGGAGCGCGTGATGAACTT-CTCGAG-AAGTTCATCACGCGCTCCCAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTGGGAGCGCGTGATGAACTTCTCGAGAAGTTCATCACGCGCTCCCACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTGGGAGCGCGTGATGAACTTCTCGAGAAGTTCATCACGCGCTCCCAC-3'

Other clones with same target sequence:

(none)