Construct: TRCN0000072206

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_276s1c1
DNA Barcode:
GTGGGAGCGCGTGATGAACTT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 276 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 276 1.650 N/A
2 human 81577 GFOD2 glucose-fructose oxidoreduc... NR_027398.1 85% 89% 3UTR 373 N/A N/A
3 mouse 94230 Cpsf1 CPSF160 NM_001164173.1 85% 89% CDS 2251 N/A N/A
4 mouse 94230 Cpsf1 CPSF160 NM_053193.2 85% 89% CDS 2251 N/A N/A
5 mouse 20377 Sfrp1 secreted frizzledrelated se... NM_013834.3 81% 85% 3UTR 1272 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTGGGAGCGCGTGATGAACTT
Hairpin Sequence:
5'-CCGG-GTGGGAGCGCGTGATGAACTT-CTCGAG-AAGTTCATCACGCGCTCCCAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTGGGAGCGCGTGATGAACTTCTCGAGAAGTTCATCACGCGCTCCCACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTGGGAGCGCGTGATGAACTTCTCGAGAAGTTCATCACGCGCTCCCAC-3'

Other clones with same target sequence:

(none)