Construct: shRNA TRCN0000072204

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_189s1c1
DNA Barcode:
TCAGTTCCAGTACGGCTCCAA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 189 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 189 2.640 N/A
2 mouse 16948 Lox lysyl oxidase NM_001286181.1 85% CDS 717 N/A N/A
3 mouse 16948 Lox lysyl oxidase NM_001286182.1 85% CDS 674 N/A N/A
4 mouse 16948 Lox lysyl oxidase NM_010728.3 85% CDS 1094 N/A N/A
5 mouse 11789 Apc adenomatosis polyposis coli NM_007462.3 89% CDS 8593 N/A N/A
6 mouse 11789 Apc adenomatosis polyposis coli XM_006525529.1 89% CDS 9067 N/A N/A
7 mouse 11789 Apc adenomatosis polyposis coli XM_006525530.1 89% CDS 8647 N/A N/A
8 mouse 11789 Apc adenomatosis polyposis coli XM_006525531.1 89% CDS 8434 N/A N/A
9 mouse 11789 Apc adenomatosis polyposis coli XM_006525532.1 89% CDS 9012 N/A N/A
10 mouse 11789 Apc adenomatosis polyposis coli XM_006525533.1 89% CDS 8407 N/A N/A
11 mouse 11789 Apc adenomatosis polyposis coli XM_006525534.1 89% CDS 8962 N/A N/A
12 mouse 11789 Apc adenomatosis polyposis coli XM_006525535.1 89% CDS 8456 N/A N/A
13 mouse 11789 Apc adenomatosis polyposis coli XM_006525536.1 89% CDS 8452 N/A N/A
14 mouse 11789 Apc adenomatosis polyposis coli XM_006525537.1 89% CDS 8432 N/A N/A
15 mouse 11789 Apc adenomatosis polyposis coli XM_006525538.1 89% CDS 8763 N/A N/A
16 mouse 11789 Apc adenomatosis polyposis coli XM_006525539.1 89% CDS 8290 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCAGTTCCAGTACGGCTCCAA
Hairpin Sequence:
5'-CCGG-TCAGTTCCAGTACGGCTCCAA-CTCGAG-TTGGAGCCGTACTGGAACTGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCAGTTCCAGTACGGCTCCAACTCGAGTTGGAGCCGTACTGGAACTGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCAGTTCCAGTACGGCTCCAACTCGAGTTGGAGCCGTACTGGAACTGA-3'

Other clones with same target sequence:

  1. TRCN0000231701