Construct: shRNA TRCN0000072202

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_506s1c1
DNA Barcode:
GCCACAACATCGAGGACGGCA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 506 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 506 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 506 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 506 0.000 N/A
4 mouse 22635 Zan zonadhesin NM_011741.2 89% CDS 13765 N/A N/A
5 mouse 22635 Zan zonadhesin XM_006504564.1 89% CDS 13750 N/A N/A
6 mouse 19821 Rnf2 ring finger protein 2 NM_011277.2 89% CDS 529 N/A N/A
7 mouse 19821 Rnf2 ring finger protein 2 XM_006529269.1 89% CDS 763 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCCACAACATCGAGGACGGCA
Hairpin Sequence:
5'-CCGG-GCCACAACATCGAGGACGGCA-CTCGAG-TGCCGTCCTCGATGTTGTGGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCCACAACATCGAGGACGGCACTCGAGTGCCGTCCTCGATGTTGTGGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCCACAACATCGAGGACGGCACTCGAGTGCCGTCCTCGATGTTGTGGC-3'

Other clones with same target sequence:

  1. TRCN0000231705