Construct: shRNA TRCN0000072201

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_49s1c1
DNA Barcode:
GTCGAGCTGGACGGCGACGTA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 49 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 49 0.000 N/A
2 CONTROL -15 lacZ lacZ lacZ.1 80% CDS 2422 N/A N/A
3 CONTROL -40 BFP BFP BFP.1 100% CDS 49 0.000 N/A
4 CONTROL -42 LacZ LacZ LacZ.1 80% CDS 2407 N/A N/A
5 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 49 0.000 N/A
6 human 6543 SLC8A2 solute carrier family 8 (so... NM_015063.2 89% CDS 1116 N/A N/A
7 human 57699 CPNE5 copine V NM_020939.1 89% CDS 1562 N/A N/A
8 human 729770 LOC729770 uncharacterized LOC729770 XR_108432.1 77% 3UTR 67 N/A N/A
9 human 729770 LOC729770 uncharacterized LOC729770 XR_112442.1 77% 3UTR 68 N/A N/A
10 mouse 16574 Kif5c kinesin family member 5C NM_008449.2 89% CDS 2794 N/A N/A
11 mouse 140570 Plxnb2 plexin B2 NM_001159521.1 85% 3UTR 6230 N/A N/A
12 mouse 140570 Plxnb2 plexin B2 NM_138749.2 85% 3UTR 6295 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTCGAGCTGGACGGCGACGTA
Hairpin Sequence:
5'-CCGG-GTCGAGCTGGACGGCGACGTA-CTCGAG-TACGTCGCCGTCCAGCTCGAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTCGAGCTGGACGGCGACGTACTCGAGTACGTCGCCGTCCAGCTCGACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTCGAGCTGGACGGCGACGTACTCGAGTACGTCGCCGTCCAGCTCGAC-3'

Other clones with same target sequence:

(none)