Construct: shRNA TRCN0000072201

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_49s1c1
DNA Barcode:
GTCGAGCTGGACGGCGACGTA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 49 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 49 0.000 N/A
2 CONTROL -40 BFP Hahn Lab BFP BFP.1 100% CDS 49 0.000 N/A
3 CONTROL -44 eGFP Hahn Lab eGFP eGFP.1 100% CDS 49 0.000 N/A
4 human 57699 CPNE5 copine V NM_020939.1 89% CDS 1562 N/A N/A
5 human 57699 CPNE5 copine V XM_005249247.1 89% CDS 1613 N/A N/A
6 human 57699 CPNE5 copine V XM_005249249.2 89% CDS 1613 N/A N/A
7 human 57699 CPNE5 copine V XM_005249252.1 89% CDS 756 N/A N/A
8 human 57699 CPNE5 copine V XM_011514768.1 89% CDS 1613 N/A N/A
9 human 57699 CPNE5 copine V XM_011514769.1 89% CDS 1562 N/A N/A
10 human 57699 CPNE5 copine V XM_011514770.1 89% CDS 1628 N/A N/A
11 human 57699 CPNE5 copine V XM_011514771.1 89% CDS 1821 N/A N/A
12 human 57699 CPNE5 copine V XM_011514773.1 89% CDS 1039 N/A N/A
13 human 57699 CPNE5 copine V XM_011514775.1 89% CDS 756 N/A N/A
14 human 57699 CPNE5 copine V XM_011514776.1 89% CDS 819 N/A N/A
15 human 57699 CPNE5 copine V XM_011514777.1 89% CDS 696 N/A N/A
16 human 57699 CPNE5 copine V XM_011514778.1 89% CDS 716 N/A N/A
17 mouse 16574 Kif5c kinesin family member 5C NM_008449.2 89% CDS 2794 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTCGAGCTGGACGGCGACGTA
Hairpin Sequence:
5'-CCGG-GTCGAGCTGGACGGCGACGTA-CTCGAG-TACGTCGCCGTCCAGCTCGAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTCGAGCTGGACGGCGACGTACTCGAGTACGTCGCCGTCCAGCTCGACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTCGAGCTGGACGGCGACGTACTCGAGTACGTCGCCGTCCAGCTCGAC-3'

Other clones with same target sequence:

(none)