Construct: shRNA TRCN0000072200

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_428s1c1
DNA Barcode:
AGTACAACTACAACAGCCACA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 428 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 428 2.160 N/A
2 CONTROL -40 BFP BFP BFP.1 95% CDS 428 N/A N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 428 2.160 N/A
4 human 84433 CARD11 caspase recruitment domain ... NM_032415.5 81% CDS 1000 N/A N/A
5 human 22828 SCAF8 SR-related CTD-associated f... NM_001286188.1 89% CDS 1191 N/A N/A
6 human 22828 SCAF8 SR-related CTD-associated f... NM_001286189.1 89% CDS 1155 N/A N/A
7 human 22828 SCAF8 SR-related CTD-associated f... NM_001286194.1 89% CDS 1092 N/A N/A
8 human 22828 SCAF8 SR-related CTD-associated f... NM_001286199.1 89% CDS 1144 N/A N/A
9 human 22828 SCAF8 SR-related CTD-associated f... NM_014892.4 89% CDS 1435 N/A N/A
10 human 105373343 LOC105373343 uncharacterized LOC105373343 XR_921638.1 85% 3UTR 438 N/A N/A
11 human 105373343 LOC105373343 uncharacterized LOC105373343 XR_938603.1 85% 3UTR 438 N/A N/A
12 mouse 18676 Phf2 PHD finger protein 2 NM_011078.3 89% CDS 2441 N/A N/A
13 mouse 77015 Mpped2 metallophosphoesterase doma... NM_001143683.1 89% 3UTR 2230 N/A N/A
14 mouse 77015 Mpped2 metallophosphoesterase doma... NM_029837.1 89% 3UTR 1943 N/A N/A
15 mouse 77015 Mpped2 metallophosphoesterase doma... XM_006500392.2 89% 3UTR 1632 N/A N/A
16 mouse 77015 Mpped2 metallophosphoesterase doma... XM_006500393.1 89% 3UTR 1958 N/A N/A
17 mouse 77015 Mpped2 metallophosphoesterase doma... XM_006500394.2 89% 3UTR 1539 N/A N/A
18 mouse 77015 Mpped2 metallophosphoesterase doma... XM_011239841.1 89% 3UTR 2470 N/A N/A
19 mouse 77015 Mpped2 metallophosphoesterase doma... XM_011239842.1 89% 3UTR 2063 N/A N/A
20 mouse 102634096 Gm11476 predicted gene 11476 XR_866991.1 85% 3UTR 1419 N/A N/A
21 mouse 102634096 Gm11476 predicted gene 11476 XR_886430.1 85% 3UTR 1419 N/A N/A
22 mouse 105246285 LOC105246285 uncharacterized LOC105246285 XR_876847.1 89% 3UTR 982 N/A N/A
23 mouse 105246285 LOC105246285 uncharacterized LOC105246285 XR_883621.1 89% 3UTR 167 N/A N/A
Download CSV

Sequence Information

Target Sequence:
AGTACAACTACAACAGCCACA
Hairpin Sequence:
5'-CCGG-AGTACAACTACAACAGCCACA-CTCGAG-TGTGGCTGTTGTAGTTGTACT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGAGTACAACTACAACAGCCACACTCGAGTGTGGCTGTTGTAGTTGTACTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAAGTACAACTACAACAGCCACACTCGAGTGTGGCTGTTGTAGTTGTACT-3'

Other clones with same target sequence:

  1. TRCN0000231744