Construct: shRNA TRCN0000072200

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_428s1c1
DNA Barcode:
AGTACAACTACAACAGCCACA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 428 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 428 2.160 N/A
2 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 428 2.160 N/A
3 human 22828 SCAF8 SR-related CTD-associated f... NM_014892.3 89% CDS 1435 N/A N/A
4 mouse 18676 Phf2 PHD finger protein 2 NM_011078.3 89% CDS 2441 N/A N/A
5 mouse 77015 Mpped2 metallophosphoesterase doma... NM_001143683.1 89% 3UTR 2230 N/A N/A
6 mouse 77015 Mpped2 metallophosphoesterase doma... NM_029837.1 89% 3UTR 1943 N/A N/A
7 mouse 100038440 Gm16508 predicted gene 16508 XR_104786.1 89% 3UTR 1199 N/A N/A
8 mouse 100038440 Gm16508 predicted gene 16508 XR_107485.1 89% 3UTR 1203 N/A N/A
Download CSV

Sequence Information

Target Sequence:
AGTACAACTACAACAGCCACA
Hairpin Sequence:
5'-CCGG-AGTACAACTACAACAGCCACA-CTCGAG-TGTGGCTGTTGTAGTTGTACT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGAGTACAACTACAACAGCCACACTCGAGTGTGGCTGTTGTAGTTGTACTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAAGTACAACTACAACAGCCACACTCGAGTGTGGCTGTTGTAGTTGTACT-3'

Other clones with same target sequence:

  1. TRCN0000231744