Construct: shRNA TRCN0000072199

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_128s1c1
DNA Barcode:
TGACCCTGAAGTTCATCTGCA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 128 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 128 2.640 N/A
2 CONTROL -40 BFP Hahn Lab BFP BFP.1 100% CDS 128 2.640 N/A
3 CONTROL -44 eGFP Hahn Lab eGFP eGFP.1 100% CDS 128 2.640 N/A
4 human 124359 CDYL2 chromodomain protein, Y-like 2 XM_011522866.1 89% 3UTR 3563 N/A N/A
5 human 124359 CDYL2 chromodomain protein, Y-like 2 XM_011522867.1 89% 3UTR 3452 N/A N/A
6 human 124359 CDYL2 chromodomain protein, Y-like 2 XM_011522868.1 89% 3UTR 3493 N/A N/A
7 human 6744 SSFA2 sperm specific antigen 2 XM_011511702.1 90% CDS 73 N/A N/A
8 human 55356 SLC22A15 solute carrier family 22, m... NM_018420.2 89% CDS 1056 N/A N/A
9 human 55356 SLC22A15 solute carrier family 22, m... XM_005271004.2 89% CDS 1005 N/A N/A
10 human 55356 SLC22A15 solute carrier family 22, m... XM_005271005.2 89% CDS 745 N/A N/A
11 human 55356 SLC22A15 solute carrier family 22, m... XM_005271006.2 89% 3UTR 968 N/A N/A
12 human 55356 SLC22A15 solute carrier family 22, m... XM_006710753.2 89% CDS 772 N/A N/A
13 human 55356 SLC22A15 solute carrier family 22, m... XM_006710754.2 89% CDS 327 N/A N/A
14 human 55356 SLC22A15 solute carrier family 22, m... XM_011541749.1 89% CDS 3871 N/A N/A
15 human 55356 SLC22A15 solute carrier family 22, m... XM_011541750.1 89% CDS 828 N/A N/A
16 human 55356 SLC22A15 solute carrier family 22, m... XM_011541751.1 89% CDS 1005 N/A N/A
17 human 55356 SLC22A15 solute carrier family 22, m... XM_011541752.1 89% CDS 1005 N/A N/A
18 human 55356 SLC22A15 solute carrier family 22, m... XM_011541753.1 89% CDS 1005 N/A N/A
19 human 55356 SLC22A15 solute carrier family 22, m... XR_426619.2 89% 3UTR 1005 N/A N/A
20 human 55356 SLC22A15 solute carrier family 22, m... XR_426620.2 89% 3UTR 1005 N/A N/A
21 human 55356 SLC22A15 solute carrier family 22, m... XR_426622.2 89% 3UTR 1005 N/A N/A
22 human 55356 SLC22A15 solute carrier family 22, m... XR_946700.1 89% 3UTR 1005 N/A N/A
23 human 55356 SLC22A15 solute carrier family 22, m... XR_946701.1 89% 3UTR 1005 N/A N/A
24 human 55356 SLC22A15 solute carrier family 22, m... XR_946702.1 89% 3UTR 1005 N/A N/A
25 human 55356 SLC22A15 solute carrier family 22, m... XR_946703.1 89% 3UTR 1005 N/A N/A
26 human 55356 SLC22A15 solute carrier family 22, m... XR_946704.1 89% 3UTR 1005 N/A N/A
27 human 55356 SLC22A15 solute carrier family 22, m... XR_946705.1 89% 3UTR 1005 N/A N/A
28 human 79895 ATP8B4 ATPase, class I, type 8B, m... NM_024837.3 89% CDS 3327 N/A N/A
29 human 79895 ATP8B4 ATPase, class I, type 8B, m... NR_073596.1 89% 3UTR 3226 N/A N/A
30 human 79895 ATP8B4 ATPase, class I, type 8B, m... NR_073597.1 89% 3UTR 3179 N/A N/A
31 human 79895 ATP8B4 ATPase, class I, type 8B, m... NR_073598.1 89% 3UTR 3434 N/A N/A
32 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_006720693.2 89% CDS 3318 N/A N/A
33 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522046.1 89% CDS 3403 N/A N/A
34 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522047.1 89% CDS 3435 N/A N/A
35 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522048.1 89% CDS 3514 N/A N/A
36 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522049.1 89% CDS 3484 N/A N/A
37 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522050.1 89% CDS 3389 N/A N/A
38 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522051.1 89% CDS 3446 N/A N/A
39 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522052.1 89% CDS 3604 N/A N/A
40 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522053.1 89% CDS 3390 N/A N/A
41 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522054.1 89% CDS 3243 N/A N/A
42 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522055.1 89% CDS 3213 N/A N/A
43 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522056.1 89% CDS 3473 N/A N/A
44 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522057.1 89% CDS 3119 N/A N/A
45 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522058.1 89% CDS 3090 N/A N/A
46 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522059.1 89% CDS 3006 N/A N/A
47 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522060.1 89% CDS 3241 N/A N/A
48 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522061.1 89% CDS 3156 N/A N/A
49 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522062.1 89% CDS 2995 N/A N/A
50 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522063.1 89% CDS 2977 N/A N/A
51 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522064.1 89% CDS 2678 N/A N/A
52 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522066.1 89% CDS 3003 N/A N/A
53 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522068.1 89% CDS 2844 N/A N/A
54 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522069.1 89% CDS 2618 N/A N/A
55 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_011522070.1 89% CDS 1919 N/A N/A
56 human 100996490 LINC01206 long intergenic non-protein... NR_104146.1 95% 3UTR 8567 N/A N/A
57 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_921392.1 89% 3UTR 34 N/A N/A
58 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_921395.1 89% 3UTR 34 N/A N/A
59 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_921396.1 89% 3UTR 34 N/A N/A
60 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_921398.1 89% 3UTR 34 N/A N/A
61 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_949299.1 89% 3UTR 34 N/A N/A
62 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_949300.1 89% 3UTR 34 N/A N/A
63 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_949301.1 89% 3UTR 34 N/A N/A
64 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_949302.1 89% 3UTR 34 N/A N/A
65 human 105373215 LOC105373215 uncharacterized LOC105373215 XR_949303.1 89% 3UTR 34 N/A N/A
66 human 105370525 LOC105370525 uncharacterized LOC105370525 XR_915680.1 89% 3UTR 3902 N/A N/A
67 human 105370525 LOC105370525 uncharacterized LOC105370525 XR_943924.1 89% 3UTR 3901 N/A N/A
68 mouse 108682 Gpt2 glutamic pyruvate transamin... NM_173866.3 89% CDS 869 N/A N/A
69 mouse 54613 St3gal6 ST3 beta-galactoside alpha-... XM_011245974.1 89% 5UTR 81 N/A N/A
70 mouse 70599 Ssfa2 sperm specific antigen 2 XM_006500165.2 90% CDS 82 N/A N/A
71 mouse 242126 Slc22a15 solute carrier family 22 (o... NM_001039371.2 89% CDS 1261 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGACCCTGAAGTTCATCTGCA
Hairpin Sequence:
5'-CCGG-TGACCCTGAAGTTCATCTGCA-CTCGAG-TGCAGATGAACTTCAGGGTCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCA-3'

Other clones with same target sequence:

  1. TRCN0000231745