Construct: shRNA TRCN0000072197

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_117s1c1
DNA Barcode:
CTACGGCAAGCTGACCCTGAA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 117 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 117 1.350 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 117 1.350 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 117 1.350 N/A
4 human 3204 HOXA7 homeobox A7 NM_006896.3 89% CDS 360 N/A N/A
5 human 23413 NCS1 neuronal calcium sensor 1 NM_001128826.1 89% CDS 435 N/A N/A
6 human 23413 NCS1 neuronal calcium sensor 1 NM_014286.3 89% CDS 566 N/A N/A
7 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_001011649.2 85% CDS 5306 N/A N/A
8 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_001272039.1 85% CDS 4853 N/A N/A
9 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_018249.5 85% CDS 5543 N/A N/A
10 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073554.1 85% 3UTR 5618 N/A N/A
11 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073555.1 85% 3UTR 5541 N/A N/A
12 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073556.1 85% 3UTR 5750 N/A N/A
13 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073557.1 85% 3UTR 5623 N/A N/A
14 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NR_073558.1 85% 3UTR 5620 N/A N/A
15 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717179.1 85% CDS 5540 N/A N/A
16 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717180.1 85% CDS 5321 N/A N/A
17 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717181.1 85% CDS 5436 N/A N/A
18 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717182.1 85% CDS 5436 N/A N/A
19 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717183.1 85% CDS 5295 N/A N/A
20 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717184.1 85% CDS 4845 N/A N/A
21 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... XM_006717185.1 85% CDS 4845 N/A N/A
22 human 100287036 LOC100287036 uncharacterized LOC100287036 NM_001242885.1 95% 5UTR 86 N/A N/A
23 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... NM_001025074.2 89% CDS 2902 N/A N/A
24 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... NM_001282961.1 89% CDS 2869 N/A N/A
25 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... XM_006517149.1 89% CDS 2717 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTACGGCAAGCTGACCCTGAA
Hairpin Sequence:
5'-CCGG-CTACGGCAAGCTGACCCTGAA-CTCGAG-TTCAGGGTCAGCTTGCCGTAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTACGGCAAGCTGACCCTGAACTCGAGTTCAGGGTCAGCTTGCCGTAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTACGGCAAGCTGACCCTGAACTCGAGTTCAGGGTCAGCTTGCCGTAG-3'

Other clones with same target sequence:

  1. TRCN0000231757