Construct: shRNA TRCN0000072194

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_231s1c1
DNA Barcode:
CCACATGAAGCAGCACGACTT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 231 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 231 4.050 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 231 4.050 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 231 4.050 N/A
4 human 102723480 LOC102723480 uncharacterized LOC102723480 XR_425191.1 85% 3UTR 295 N/A N/A
5 human 102723480 LOC102723480 uncharacterized LOC102723480 XR_425193.1 85% 3UTR 262 N/A N/A
6 human 102723480 LOC102723480 uncharacterized LOC102723480 XR_426725.1 85% 3UTR 297 N/A N/A
7 human 102723480 LOC102723480 uncharacterized LOC102723480 XR_426727.1 85% 3UTR 264 N/A N/A
8 human 102723480 LOC102723480 uncharacterized LOC102723480 XR_431203.1 85% 3UTR 297 N/A N/A
9 human 102723480 LOC102723480 uncharacterized LOC102723480 XR_431205.1 85% 3UTR 264 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCACATGAAGCAGCACGACTT
Hairpin Sequence:
5'-CCGG-CCACATGAAGCAGCACGACTT-CTCGAG-AAGTCGTGCTGCTTCATGTGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCACATGAAGCAGCACGACTTCTCGAGAAGTCGTGCTGCTTCATGTGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCACATGAAGCAGCACGACTTCTCGAGAAGTCGTGCTGCTTCATGTGG-3'

Other clones with same target sequence:

  1. TRCN0000231762