Construct: shRNA TRCN0000072192

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_477s1c1
DNA Barcode:
GAACGGCATCAAGGTGAACTT
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 477 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 477 4.950 N/A
2 CONTROL -40 BFP BFP BFP.1 95% CDS 477 N/A N/A
3 CONTROL -44 eGFP eGFP eGFP.1 95% CDS 477 N/A N/A
4 human 137970 UNC5D unc-5 homolog D (C. elegans) NM_080872.2 89% CDS 2507 N/A N/A
5 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_006716288.2 89% CDS 2466 N/A N/A
6 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544398.1 89% CDS 2547 N/A N/A
7 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544399.1 89% CDS 2505 N/A N/A
8 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544400.1 89% CDS 2457 N/A N/A
9 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544401.1 89% CDS 2451 N/A N/A
10 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544402.1 89% CDS 2322 N/A N/A
11 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544403.1 89% CDS 2289 N/A N/A
12 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544404.1 89% CDS 2283 N/A N/A
13 human 137970 UNC5D unc-5 homolog D (C. elegans) XM_011544405.1 89% CDS 924 N/A N/A
14 human 11116 FGFR1OP FGFR1 oncogene partner NM_001278690.1 90% CDS 186 N/A N/A
15 human 11116 FGFR1OP FGFR1 oncogene partner NM_007045.3 90% CDS 186 N/A N/A
16 human 11116 FGFR1OP FGFR1 oncogene partner NM_194429.2 90% CDS 186 N/A N/A
17 human 94030 LRRC4B leucine rich repeat contain... NM_001080457.1 89% CDS 422 N/A N/A
18 human 94030 LRRC4B leucine rich repeat contain... XM_005259429.3 89% CDS 993 N/A N/A
19 human 94030 LRRC4B leucine rich repeat contain... XM_006723506.2 89% CDS 714 N/A N/A
20 human 94030 LRRC4B leucine rich repeat contain... XM_011527520.1 89% CDS 1849 N/A N/A
21 human 102724826 ZNF337-AS1 ZNF337 antisense RNA 1 NR_126467.1 85% 3UTR 320 N/A N/A
22 mouse 17967 Ncam1 neural cell adhesion molecu... NM_001081445.1 89% CDS 2185 N/A N/A
23 mouse 17967 Ncam1 neural cell adhesion molecu... NM_001113204.1 89% CDS 2185 N/A N/A
24 mouse 17967 Ncam1 neural cell adhesion molecu... NM_010875.3 89% CDS 2185 N/A N/A
25 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510055.1 89% CDS 2681 N/A N/A
26 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510056.1 89% CDS 2681 N/A N/A
27 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510057.1 89% CDS 2678 N/A N/A
28 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510058.2 89% CDS 2244 N/A N/A
29 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510059.1 89% CDS 2651 N/A N/A
30 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510060.1 89% CDS 2633 N/A N/A
31 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510061.1 89% CDS 2630 N/A N/A
32 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510062.1 89% CDS 2591 N/A N/A
33 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510063.1 89% CDS 2588 N/A N/A
34 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510064.1 89% CDS 2576 N/A N/A
35 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510065.1 89% CDS 2576 N/A N/A
36 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510066.1 89% CDS 2573 N/A N/A
37 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510067.1 89% CDS 2573 N/A N/A
38 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510068.1 89% CDS 2681 N/A N/A
39 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510069.1 89% CDS 2681 N/A N/A
40 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510070.1 89% CDS 2576 N/A N/A
41 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510071.1 89% CDS 2573 N/A N/A
42 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510072.1 89% CDS 2543 N/A N/A
43 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510073.2 89% CDS 2681 N/A N/A
44 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510074.2 89% CDS 2681 N/A N/A
45 mouse 17967 Ncam1 neural cell adhesion molecu... XM_006510075.2 89% CDS 2573 N/A N/A
46 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242413.1 89% CDS 2546 N/A N/A
47 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242414.1 89% CDS 2546 N/A N/A
48 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242415.1 89% CDS 2543 N/A N/A
49 mouse 17967 Ncam1 neural cell adhesion molecu... XM_011242416.1 89% CDS 2651 N/A N/A
50 mouse 21922 Clec3b C-type lectin domain family... NM_011606.2 89% CDS 314 N/A N/A
51 mouse 52666 Arhgef25 Rho guanine nucleotide exch... NM_001166413.1 89% CDS 1371 N/A N/A
52 mouse 52666 Arhgef25 Rho guanine nucleotide exch... NM_028027.3 89% CDS 1433 N/A N/A
53 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513878.2 89% CDS 1983 N/A N/A
54 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513879.2 89% CDS 1279 N/A N/A
55 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513880.1 89% CDS 1345 N/A N/A
56 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XM_006513881.1 89% CDS 1491 N/A N/A
57 mouse 52666 Arhgef25 Rho guanine nucleotide exch... XR_871718.1 89% 3UTR 1489 N/A N/A
58 mouse 75296 Fgfr1op Fgfr1 oncogene partner NM_001197046.1 90% CDS 169 N/A N/A
59 mouse 75296 Fgfr1op Fgfr1 oncogene partner NM_201230.5 90% CDS 169 N/A N/A
60 mouse 75296 Fgfr1op Fgfr1 oncogene partner XM_006523355.1 90% CDS 202 N/A N/A
61 mouse 75296 Fgfr1op Fgfr1 oncogene partner XM_006523356.1 90% CDS 202 N/A N/A
62 mouse 75296 Fgfr1op Fgfr1 oncogene partner XM_006523357.1 90% CDS 202 N/A N/A
63 mouse 14107 Fat1 FAT tumor suppressor homolo... NM_001081286.2 89% CDS 5700 N/A N/A
64 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509267.2 89% CDS 6670 N/A N/A
65 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509268.2 89% CDS 6029 N/A N/A
66 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509270.2 89% CDS 6670 N/A N/A
67 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509271.2 89% CDS 6601 N/A N/A
68 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509272.2 89% CDS 6670 N/A N/A
69 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509273.2 89% CDS 6672 N/A N/A
70 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509274.2 89% CDS 6601 N/A N/A
71 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509275.2 89% CDS 6678 N/A N/A
72 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509276.2 89% CDS 6678 N/A N/A
73 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_006509277.2 89% CDS 6601 N/A N/A
74 mouse 14107 Fat1 FAT tumor suppressor homolo... XM_011242173.1 89% CDS 6210 N/A N/A
75 mouse 380608 Tagap1 T cell activation GTPase ac... NM_147155.2 90% CDS 117 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GAACGGCATCAAGGTGAACTT
Hairpin Sequence:
5'-CCGG-GAACGGCATCAAGGTGAACTT-CTCGAG-AAGTTCACCTTGATGCCGTTC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTC-3'

Other clones with same target sequence:

  1. TRCN0000231760