Construct: TRCN0000072192
Construct Description:
- Construct Type:
- shRNA
- Other Identifiers:
- clonetechGfp_477s1c1
- DNA Barcode:
- GAACGGCATCAAGGTGAACTT
- Vector:
- pLKO.1
Original Target:
- Taxon:
- CONTROL
- Gene:
- Clontech GFP
- Gene Description:
- clonetechGfp
- Transcript:
- clonetech clonetechGfp.1 (CURRENT)
- Match location:
- Position 477 (CDS)
Current transcripts matched by this hairpin:
| Taxon | Gene | Symbol | Description | Transcript | Match %[?] Percent match of hairpin target sequence (21mer) to transcript RNA sequence. |
SDR Match %[?] Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence.
|
Region | Start Pos.[?] Start position of hairpin's match to the targetted transcript sequence (1-based). |
Intrinsic Score[?] Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance. |
Adjusted Score[?] Also called "specificity score", this is a function of intrinsic score, specificity factor, and a third factor relating to the specificity of the microRNA seed region of the target sequence. |
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | CONTROL | -10 | GFP | clonetechGfp | clonetechGfp.1 | 100% | 100% | CDS | 477 | 4.950 | N/A |
Sequence Information
- Target Sequence:
- GAACGGCATCAAGGTGAACTT
- Hairpin Sequence:
- 5'-CCGG-GAACGGCATCAAGGTGAACTT-CTCGAG-AAGTTCACCTTGATGCCGTTC-TTTTTG-3'
Oligo design for arrayed cloning:
- Forward sequence:
- 5'-CCGGGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTCTTTTTG-3'
- Reverse sequence:
- 5'-AATTCAAAAAGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTC-3'