Construct: shRNA TRCN0000072192

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_477s1c1
DNA Barcode:
GAACGGCATCAAGGTGAACTT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 477 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 477 4.950 N/A
2 human 137970 UNC5D unc-5 homolog D (C. elegans) NM_080872.2 89% CDS 2507 N/A N/A
3 human 11116 FGFR1OP FGFR1 oncogene partner NM_007045.2 90% CDS 175 N/A N/A
4 human 11116 FGFR1OP FGFR1 oncogene partner NM_194429.1 90% CDS 175 N/A N/A
5 human 94030 LRRC4B leucine rich repeat contain... NM_001080457.1 89% CDS 422 N/A N/A
6 human 100505685 LOC100505685 uncharacterized LOC100505685 XR_109847.1 85% 3UTR 424 N/A N/A
7 human 100505685 LOC100505685 uncharacterized LOC100505685 XR_112694.1 85% 3UTR 424 N/A N/A
8 mouse 17967 Ncam1 neural cell adhesion molecu... NM_001081445.1 89% CDS 2185 N/A N/A
9 mouse 17967 Ncam1 neural cell adhesion molecu... NM_001113204.1 89% CDS 2185 N/A N/A
10 mouse 17967 Ncam1 neural cell adhesion molecu... NM_010875.3 89% CDS 2185 N/A N/A
11 mouse 21922 Clec3b C-type lectin domain family... NM_011606.2 89% CDS 314 N/A N/A
12 mouse 52666 Arhgef25 Rho guanine nucleotide exch... NM_001166413.1 89% CDS 1371 N/A N/A
13 mouse 52666 Arhgef25 Rho guanine nucleotide exch... NM_028027.3 89% CDS 1433 N/A N/A
14 mouse 75296 Fgfr1op Fgfr1 oncogene partner NM_001197046.1 90% CDS 169 N/A N/A
15 mouse 75296 Fgfr1op Fgfr1 oncogene partner NM_201230.5 90% CDS 169 N/A N/A
16 mouse 14107 Fat1 FAT tumor suppressor homolo... NM_001081286.2 89% CDS 5700 N/A N/A
17 mouse 380608 Tagap1 T cell activation GTPase ac... NM_147155.2 90% CDS 117 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GAACGGCATCAAGGTGAACTT
Hairpin Sequence:
5'-CCGG-GAACGGCATCAAGGTGAACTT-CTCGAG-AAGTTCACCTTGATGCCGTTC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGAACGGCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGCCGTTC-3'

Other clones with same target sequence:

  1. TRCN0000231760