Construct: shRNA TRCN0000072189

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_197s1c1
DNA Barcode:
CCTACGGCGTGCAGTGCTTCA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 197 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 197 0.000 N/A
2 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 197 0.000 N/A
3 human 5609 MAP2K7 mitogen-activated protein k... NM_001297555.1 89% CDS 743 N/A N/A
4 human 5609 MAP2K7 mitogen-activated protein k... NM_001297556.1 89% CDS 695 N/A N/A
5 human 5609 MAP2K7 mitogen-activated protein k... NM_145185.3 89% CDS 695 N/A N/A
6 human 5609 MAP2K7 mitogen-activated protein k... XM_006722800.1 89% CDS 743 N/A N/A
7 human 166752 FREM3 FRAS1 related extracellular... NM_001168235.1 89% CDS 6322 N/A N/A
8 mouse 13557 E2f3 E2F transcription factor 3 NM_001289920.1 89% 3UTR 4277 N/A N/A
9 mouse 13557 E2f3 E2F transcription factor 3 NM_010093.3 89% 3UTR 4795 N/A N/A
10 mouse 13557 E2f3 E2F transcription factor 3 XM_006516542.1 89% 3UTR 5791 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCTACGGCGTGCAGTGCTTCA
Hairpin Sequence:
5'-CCGG-CCTACGGCGTGCAGTGCTTCA-CTCGAG-TGAAGCACTGCACGCCGTAGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCTACGGCGTGCAGTGCTTCACTCGAGTGAAGCACTGCACGCCGTAGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCTACGGCGTGCAGTGCTTCACTCGAGTGAAGCACTGCACGCCGTAGG-3'

Other clones with same target sequence:

  1. TRCN0000231765