Construct: shRNA TRCN0000072188

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_226s1c1
DNA Barcode:
CCCGACCACATGAAGCAGCAC
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 226 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 226 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 226 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 226 0.000 N/A
4 mouse 18548 Pcsk1 proprotein convertase subti... NM_013628.2 89% CDS 1867 N/A N/A
5 mouse 18548 Pcsk1 proprotein convertase subti... XM_006517153.1 89% CDS 1979 N/A N/A
6 mouse 18548 Pcsk1 proprotein convertase subti... XM_006517154.1 89% CDS 1910 N/A N/A
7 mouse 18548 Pcsk1 proprotein convertase subti... XM_006517155.1 89% CDS 1938 N/A N/A
8 mouse 11846 Arg1 arginase, liver NM_007482.3 89% 5UTR 58 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCCGACCACATGAAGCAGCAC
Hairpin Sequence:
5'-CCGG-CCCGACCACATGAAGCAGCAC-CTCGAG-GTGCTGCTTCATGTGGTCGGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCCGACCACATGAAGCAGCACCTCGAGGTGCTGCTTCATGTGGTCGGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCCGACCACATGAAGCAGCACCTCGAGGTGCTGCTTCATGTGGTCGGG-3'

Other clones with same target sequence:

  1. TRCN0000231763