Construct: TRCN0000072188

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_226s1c1
DNA Barcode:
CCCGACCACATGAAGCAGCAC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 226 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 226 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 226 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 226 0.000 N/A
4 human 10039 PARP3 ADPribosyltransferase (NAD+... NM_001003931.2 85% 89% 5UTR 50 N/A N/A
5 human 10039 PARP3 ADPribosyltransferase (NAD+... NM_005485.4 85% 89% 5UTR 50 N/A N/A
6 mouse 18548 Pcsk1 prohormone convertase 1/3 NM_013628.2 80% 89% CDS 1867 N/A N/A
7 mouse 70808 4632415L05Rik RIKEN cDNA 4632415L05 gene NR_027985.1 77% 85% 3UTR 551 N/A N/A
8 mouse 11846 Arg1 arginase, liver NM_007482.3 85% 89% 5UTR 58 N/A N/A
9 mouse 100861673 LOC100861673 uncharacterized LOC100861673 XR_140838.1 78% 80% 3UTR 459 N/A N/A
10 mouse 100861673 LOC100861673 uncharacterized LOC100861673 XR_142271.1 78% 80% 3UTR 459 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCCGACCACATGAAGCAGCAC
Hairpin Sequence:
5'-CCGG-CCCGACCACATGAAGCAGCAC-CTCGAG-GTGCTGCTTCATGTGGTCGGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCCGACCACATGAAGCAGCACCTCGAGGTGCTGCTTCATGTGGTCGGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCCGACCACATGAAGCAGCACCTCGAGGTGCTGCTTCATGTGGTCGGG-3'

Other clones with same target sequence:

  1. TRCN0000231763