Construct: shRNA TRCN0000072186

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_587s1c1
DNA Barcode:
TGCCCGACAACCACTACCTGA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 587 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 587 0.880 N/A
2 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 587 0.880 N/A
3 human 4035 LRP1 low density lipoprotein rec... NM_002332.2 89% CDS 4110 N/A N/A
4 human 388165 UBE2Q2P1 ubiquitin-conjugating enzym... NR_003661.2 85% 3UTR 1368 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGCCCGACAACCACTACCTGA
Hairpin Sequence:
5'-CCGG-TGCCCGACAACCACTACCTGA-CTCGAG-TCAGGTAGTGGTTGTCGGGCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGCCCGACAACCACTACCTGACTCGAGTCAGGTAGTGGTTGTCGGGCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGCCCGACAACCACTACCTGACTCGAGTCAGGTAGTGGTTGTCGGGCA-3'

Other clones with same target sequence:

  1. TRCN0000231746