Construct: TRCN0000072182

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_693s1c1
DNA Barcode:
TCTCGGCATGGACGAGCTGTA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 693 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 693 1.350 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 693 1.350 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 693 1.350 N/A
4 mouse 15370 Nr4a1 hormone receptor NM_010444.2 81% 85% CDS 643 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCTCGGCATGGACGAGCTGTA
Hairpin Sequence:
5'-CCGG-TCTCGGCATGGACGAGCTGTA-CTCGAG-TACAGCTCGTCCATGCCGAGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCTCGGCATGGACGAGCTGTACTCGAGTACAGCTCGTCCATGCCGAGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCTCGGCATGGACGAGCTGTACTCGAGTACAGCTCGTCCATGCCGAGA-3'

Other clones with same target sequence:

  1. TRCN0000231752