Construct: TRCN0000072181

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_437s1c1
DNA Barcode:
ACAACAGCCACAACGTCTATA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 437 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 437 13.200 N/A
2 CONTROL -40 BFP BFP BFP.1 95% 94% CDS 437 N/A N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 437 13.200 N/A
4 human 5794 PTPRH protein tyrosine phosphatas... NM_001161440.1 77% 85% CDS 308 N/A N/A
5 human 5794 PTPRH protein tyrosine phosphatas... NM_002842.3 77% 85% CDS 308 N/A N/A
6 human 10914 PAPOLA poly(A) polymerase alpha NM_001252007.1 81% 85% 3UTR 1742 N/A N/A
7 human 219285 SAMD9L sterile alpha motif domain ... NM_152703.2 81% 85% 3UTR 7002 N/A N/A
8 human 100506877 LOC100506877 uncharacterized LOC100506877 XR_109739.1 73% 80% 3UTR 91 N/A N/A
9 mouse 30046 Zfp292 zinc finger protein 15 NM_013889.2 77% 85% CDS 4289 N/A N/A
10 mouse 239420 Csmd3 CUB and Sushi multiple doma... NM_001081391.2 80% 89% 5UTR 25 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACAACAGCCACAACGTCTATA
Hairpin Sequence:
5'-CCGG-ACAACAGCCACAACGTCTATA-CTCGAG-TATAGACGTTGTGGCTGTTGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACAACAGCCACAACGTCTATACTCGAGTATAGACGTTGTGGCTGTTGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACAACAGCCACAACGTCTATACTCGAGTATAGACGTTGTGGCTGTTGT-3'

Other clones with same target sequence:

  1. TRCN0000231753
  2. TRCN0000559393
  3. TRCN0000559394
  4. TRCN0000559395
  5. TRCN0000559396
  6. TRCN0000559397
  7. TRCN0000559399
  8. TRCN0000559401
  9. TRCN0000559403
  10. TRCN0000559407
  11. TRCN0000559408