Construct: shRNA TRCN0000072181

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_437s1c1
DNA Barcode:
ACAACAGCCACAACGTCTATA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 437 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 437 13.200 N/A
2 CONTROL -40 BFP BFP BFP.1 95% CDS 437 N/A N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 437 13.200 N/A
4 human 5794 PTPRH protein tyrosine phosphatas... NM_001161440.2 85% CDS 308 N/A N/A
5 human 5794 PTPRH protein tyrosine phosphatas... NM_002842.4 85% CDS 308 N/A N/A
6 human 5794 PTPRH protein tyrosine phosphatas... XM_011527183.1 85% CDS 329 N/A N/A
7 human 5794 PTPRH protein tyrosine phosphatas... XM_011527184.1 85% CDS 329 N/A N/A
8 human 5794 PTPRH protein tyrosine phosphatas... XM_011527185.1 85% CDS 329 N/A N/A
9 human 5794 PTPRH protein tyrosine phosphatas... XM_011527186.1 85% CDS 329 N/A N/A
10 human 5794 PTPRH protein tyrosine phosphatas... XM_011527187.1 85% CDS 329 N/A N/A
11 human 5794 PTPRH protein tyrosine phosphatas... XM_011527188.1 85% 5UTR 278 N/A N/A
12 human 5794 PTPRH protein tyrosine phosphatas... XM_011527189.1 85% 5UTR 172 N/A N/A
13 human 5794 PTPRH protein tyrosine phosphatas... XM_011527190.1 85% CDS 329 N/A N/A
14 human 5794 PTPRH protein tyrosine phosphatas... XR_935847.1 85% 3UTR 329 N/A N/A
15 human 10914 PAPOLA poly(A) polymerase alpha NM_001252007.1 85% 3UTR 1742 N/A N/A
16 human 219285 SAMD9L sterile alpha motif domain ... NM_001303496.1 85% 3UTR 6818 N/A N/A
17 human 219285 SAMD9L sterile alpha motif domain ... NM_001303497.1 85% 3UTR 6647 N/A N/A
18 human 219285 SAMD9L sterile alpha motif domain ... NM_001303498.1 85% 3UTR 6383 N/A N/A
19 human 219285 SAMD9L sterile alpha motif domain ... NM_001303500.1 85% 3UTR 6251 N/A N/A
20 human 219285 SAMD9L sterile alpha motif domain ... NM_152703.3 85% 3UTR 7023 N/A N/A
21 human 219285 SAMD9L sterile alpha motif domain ... XM_005250193.2 85% 3UTR 6447 N/A N/A
22 human 219285 SAMD9L sterile alpha motif domain ... XM_006715890.1 85% 3UTR 5824 N/A N/A
23 human 219285 SAMD9L sterile alpha motif domain ... XM_011515903.1 85% 3UTR 6700 N/A N/A
24 mouse 30046 Zfp292 zinc finger protein 292 NM_013889.2 85% CDS 4289 N/A N/A
25 mouse 30046 Zfp292 zinc finger protein 292 XM_006537977.1 85% CDS 919 N/A N/A
26 mouse 30046 Zfp292 zinc finger protein 292 XM_006537978.2 85% 3UTR 6173 N/A N/A
27 mouse 239420 Csmd3 CUB and Sushi multiple doma... NM_001081391.2 89% 5UTR 25 N/A N/A
28 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_006520909.2 89% 5UTR 215 N/A N/A
29 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_006520910.2 89% 5UTR 215 N/A N/A
30 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245610.1 89% 5UTR 215 N/A N/A
31 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245611.1 89% 5UTR 215 N/A N/A
32 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245612.1 89% 5UTR 239 N/A N/A
33 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245613.1 89% 5UTR 240 N/A N/A
34 mouse 239420 Csmd3 CUB and Sushi multiple doma... XM_011245614.1 89% 5UTR 267 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACAACAGCCACAACGTCTATA
Hairpin Sequence:
5'-CCGG-ACAACAGCCACAACGTCTATA-CTCGAG-TATAGACGTTGTGGCTGTTGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACAACAGCCACAACGTCTATACTCGAGTATAGACGTTGTGGCTGTTGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACAACAGCCACAACGTCTATACTCGAGTATAGACGTTGTGGCTGTTGT-3'

Other clones with same target sequence:

  1. TRCN0000231753
  2. TRCN0000559393
  3. TRCN0000559394
  4. TRCN0000559395
  5. TRCN0000559396
  6. TRCN0000559397
  7. TRCN0000559399
  8. TRCN0000559401
  9. TRCN0000559403
  10. TRCN0000559407
  11. TRCN0000559408