Construct: TRCN0000072180

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_453s1c1
DNA Barcode:
CTATATCATGGCCGACAAGCA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 453 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 453 2.640 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 453 2.640 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 453 2.640 N/A
4 human 2903 GRIN2A NmethylDaspartate receptor ... NM_000833.3 86% 90% CDS 705 N/A N/A
5 human 2903 GRIN2A NmethylDaspartate receptor ... NM_001134407.1 86% 90% CDS 943 N/A N/A
6 human 2903 GRIN2A NmethylDaspartate receptor ... NM_001134408.1 86% 90% CDS 604 N/A N/A
7 human 55757 UGGT2 UDPglucose:glycoprotein glu... NM_020121.3 73% 80% CDS 1535 N/A N/A
8 mouse 14811 Grin2a GluRepsilon1 NM_008170.2 86% 90% CDS 395 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTATATCATGGCCGACAAGCA
Hairpin Sequence:
5'-CCGG-CTATATCATGGCCGACAAGCA-CTCGAG-TGCTTGTCGGCCATGATATAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTATATCATGGCCGACAAGCACTCGAGTGCTTGTCGGCCATGATATAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTATATCATGGCCGACAAGCACTCGAGTGCTTGTCGGCCATGATATAG-3'

Other clones with same target sequence:

  1. TRCN0000231754