Construct: shRNA TRCN0000072179

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_228s1c1
DNA Barcode:
CGACCACATGAAGCAGCACGA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 228 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 228 0.720 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 228 0.720 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 228 0.720 N/A
4 human 55226 NAT10 N-acetyltransferase 10 (GCN... NM_001144030.1 85% CDS 2834 N/A N/A
5 human 55226 NAT10 N-acetyltransferase 10 (GCN... NM_024662.2 85% CDS 3049 N/A N/A
6 human 63977 PRDM15 PR domain containing 15 NM_001040424.2 89% CDS 2508 N/A N/A
7 human 63977 PRDM15 PR domain containing 15 NM_001282934.1 89% CDS 2568 N/A N/A
8 human 63977 PRDM15 PR domain containing 15 NM_022115.4 89% CDS 3495 N/A N/A
9 human 63977 PRDM15 PR domain containing 15 NR_104257.1 89% 3UTR 2516 N/A N/A
10 human 63977 PRDM15 PR domain containing 15 NR_104258.1 89% 3UTR 2396 N/A N/A
11 human 63977 PRDM15 PR domain containing 15 NR_104260.1 89% 3UTR 2363 N/A N/A
12 human 63977 PRDM15 PR domain containing 15 XM_006724039.2 89% CDS 2350 N/A N/A
13 human 63977 PRDM15 PR domain containing 15 XM_006724040.2 89% CDS 2290 N/A N/A
14 human 63977 PRDM15 PR domain containing 15 XM_011529671.1 89% CDS 2376 N/A N/A
15 human 63977 PRDM15 PR domain containing 15 XM_011529672.1 89% CDS 2463 N/A N/A
16 human 63977 PRDM15 PR domain containing 15 XM_011529673.1 89% CDS 2471 N/A N/A
17 human 63977 PRDM15 PR domain containing 15 XM_011529674.1 89% CDS 2380 N/A N/A
18 human 63977 PRDM15 PR domain containing 15 XM_011529675.1 89% CDS 2424 N/A N/A
19 human 63977 PRDM15 PR domain containing 15 XM_011529676.1 89% CDS 4840 N/A N/A
20 human 63977 PRDM15 PR domain containing 15 XM_011529677.1 89% CDS 2412 N/A N/A
21 human 63977 PRDM15 PR domain containing 15 XM_011529678.1 89% CDS 2379 N/A N/A
22 human 63977 PRDM15 PR domain containing 15 XM_011529679.1 89% CDS 2467 N/A N/A
23 human 63977 PRDM15 PR domain containing 15 XM_011529680.1 89% CDS 2377 N/A N/A
24 human 63977 PRDM15 PR domain containing 15 XM_011529681.1 89% CDS 2397 N/A N/A
25 human 63977 PRDM15 PR domain containing 15 XM_011529683.1 89% CDS 3211 N/A N/A
26 human 63977 PRDM15 PR domain containing 15 XR_937542.1 89% 3UTR 2482 N/A N/A
27 human 105375457 LOC105375457 uncharacterized LOC105375457 XR_927876.1 85% 3UTR 356 N/A N/A
28 human 105375457 LOC105375457 uncharacterized LOC105375457 XR_956068.1 85% 3UTR 356 N/A N/A
29 mouse 114875 Plcz1 phospholipase C, zeta 1 NM_054066.4 89% CDS 1851 N/A N/A
30 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506899.2 89% CDS 1853 N/A N/A
31 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506900.2 89% CDS 1853 N/A N/A
32 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506901.2 89% CDS 1853 N/A N/A
33 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506902.2 89% CDS 1883 N/A N/A
34 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506904.2 89% CDS 1035 N/A N/A
35 mouse 13801 Enam enamelin NM_017468.3 89% CDS 738 N/A N/A
36 mouse 13801 Enam enamelin XM_011249406.1 89% CDS 433 N/A N/A
37 mouse 17188 Maz MYC-associated zinc finger ... NM_010772.1 89% CDS 1281 N/A N/A
38 mouse 17188 Maz MYC-associated zinc finger ... XM_006507402.1 89% CDS 1355 N/A N/A
39 mouse 73942 Fam151b family with sequence simila... NM_001163627.1 89% CDS 430 N/A N/A
40 mouse 73942 Fam151b family with sequence simila... XM_006517777.1 89% CDS 258 N/A N/A
41 mouse 100579151 Gm16833 predicted gene, 16833 NR_045754.1 89% 3UTR 511 N/A N/A
42 mouse 102636372 Gm33457 predicted gene, 33457 XR_374258.2 89% 3UTR 312 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGACCACATGAAGCAGCACGA
Hairpin Sequence:
5'-CCGG-CGACCACATGAAGCAGCACGA-CTCGAG-TCGTGCTGCTTCATGTGGTCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGACCACATGAAGCAGCACGACTCGAGTCGTGCTGCTTCATGTGGTCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGACCACATGAAGCAGCACGACTCGAGTCGTGCTGCTTCATGTGGTCG-3'

Other clones with same target sequence:

  1. TRCN0000231749