Construct: TRCN0000072179

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_228s1c1
DNA Barcode:
CGACCACATGAAGCAGCACGA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 228 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 228 0.720 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 228 0.720 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 228 0.720 N/A
4 human 55226 NAT10 Nacetyltransferaselike protein NM_001144030.1 77% 85% CDS 2834 N/A N/A
5 human 55226 NAT10 Nacetyltransferaselike protein NM_024662.2 77% 85% CDS 3049 N/A N/A
6 human 63977 PRDM15 zinc finger protein 298 NM_001040424.1 85% 89% CDS 2499 N/A N/A
7 human 63977 PRDM15 zinc finger protein 298 NM_022115.3 85% 89% CDS 3495 N/A N/A
8 mouse 114875 Plcz1 phospholipase C zeta NM_054066.4 80% 89% CDS 1851 N/A N/A
9 mouse 13801 Enam enamelin NM_017468.3 85% 89% CDS 738 N/A N/A
10 mouse 17188 Maz MYCassociated zinc finger p... NM_010772.1 80% 89% CDS 1281 N/A N/A
11 mouse 73942 Fam151b family with sequence simila... NM_001163627.1 80% 89% CDS 430 N/A N/A
12 mouse 100579151 Gm16833 predicted gene, 16833 NR_045754.1 80% 89% 3UTR 511 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGACCACATGAAGCAGCACGA
Hairpin Sequence:
5'-CCGG-CGACCACATGAAGCAGCACGA-CTCGAG-TCGTGCTGCTTCATGTGGTCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGACCACATGAAGCAGCACGACTCGAGTCGTGCTGCTTCATGTGGTCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGACCACATGAAGCAGCACGACTCGAGTCGTGCTGCTTCATGTGGTCG-3'

Other clones with same target sequence:

  1. TRCN0000231749