Construct: shRNA TRCN0000072178

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_438s1c1
DNA Barcode:
CAACAGCCACAACGTCTATAT
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 438 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 438 13.200 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 438 13.200 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 438 13.200 N/A
4 human 10914 PAPOLA poly(A) polymerase alpha NM_001252007.1 90% 3UTR 1743 N/A N/A
5 mouse 102636861 LOC102636861 uncharacterized LOC102636861 XR_376672.1 89% 3UTR 406 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAACAGCCACAACGTCTATAT
Hairpin Sequence:
5'-CCGG-CAACAGCCACAACGTCTATAT-CTCGAG-ATATAGACGTTGTGGCTGTTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAACAGCCACAACGTCTATATCTCGAGATATAGACGTTGTGGCTGTTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAACAGCCACAACGTCTATATCTCGAGATATAGACGTTGTGGCTGTTG-3'

Other clones with same target sequence:

  1. TRCN0000231750