Nucleotide Global Alignment

Description

Query:
BRDN0000464781
Subject:
BFP.1
Aligned Length:
720
Identities:
711
Gaps:
3

Alignment

Query   1  ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGG  74
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct   1  ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGG  74

Query  75  CCACAAGTTCAGCGTGTCTGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCA  148
           ||||||||||||||||||.|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  75  CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCA  148

Query 149  CCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGC  222
           ||||||||||||||||||||||||||||||||||||||||||||||||.|.|||||||.|||||||||||||||
Sbjct 149  CCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGAGCCACGGCGTCCAGTGCTTCAGCCGC  222

Query 223  TACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCAT  296
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 223  TACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCAT  296

Query 297  CTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCA  370
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 297  CTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCA  370

Query 371  TCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGC  444
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||.|||||||
Sbjct 371  TCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTTCAACAGC  444

Query 445  CACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGCGAACTTCAAGATCCGCCACAACATCGA  518
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 445  CACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGCGAACTTCAAGATCCGCCACAACATCGA  518

Query 519  GGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCG  592
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 519  GGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCG  592

Query 593  ACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTG  666
           |||.||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 593  ACAGCCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTG  666

Query 667  GAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG---  717
           |||||||||||||||||||||||||||||||||||||||||||||||||||   
Sbjct 667  GAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTTG  720