Nucleotide Global Alignment

Description

Query:
BRDN0000464780
Subject:
lacZ.1
Aligned Length:
3219
Identities:
2954
Gaps:
160

Alignment

Query    1  ------ATGAT---AGAT------CCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT  59
                  |||||   .|||      .|||||||.|||||||||||||||||||||||||||||||||||||||||
Sbjct    1  ATGACTATGATTACGGATTCTCTGGCCGTCGTATTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT  74

Query   60  TAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCC  133
            ||||||||||||.|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct   75  TAATCGCCTTGCGGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCC  148

Query  134  AACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGG  207
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  149  AACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGG  222

Query  208  CTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCC  281
            ||||||||||||||||||||.|||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  223  CTGGAGTGCGATCTTCCTGACGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCC  296

Query  282  CATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTT  355
            .|||||||||||||||||||||||||||||||||||||||||||||||||||.|||||||||||||.|||||||
Sbjct  297  TATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCGCGGAGAATCCGACAGGTTGTT  370

Query  356  ACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAAC  429
            |||||||||||||||||.||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  371  ACTCGCTCACATTTAATATTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAAC  444

Query  430  TCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGA  503
            |||||||||||||||||||||||||||||||||||||||||||||||||||||.||.|||||||||||||||||
Sbjct  445  TCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGCCGMTTGCCGTCTGAATTTGA  518

Query  504  CCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGGAGTGACGGCAGTTATC  577
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  519  CCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGGAGTGACGGCAGTTATC  592

Query  578  TGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAA  651
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||.||.|||
Sbjct  593  TGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACCACGCAA  666

Query  652  ATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGAT  725
            ||||||||||||||.|||.||||||.||||||||||||||||||||||||.|||||||||||.|||||||||||
Sbjct  667  ATCAGCGATTTCCAAGTTACCACTCTCTTTAATGATGATTTCAGCCGCGCGGTACTGGAGGCAGAAGTTCAGAT  740

Query  726  GTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCA  799
            ||.|||||||.||||.||..|.||.|||||.||.||||||||.|||||||||||||||||||||||||||||||
Sbjct  741  GTACGGCGAGCTGCGCGATGAACTGCGGGTGACGGTTTCTTTGTGGCAGGGTGAAACGCAGGTCGCCAGCGGCA  814

Query  800  CCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTC  873
            |||||||||||||||||||||||||||||||||||||.||||||||||||||||||||||||||.||||||||.
Sbjct  815  CCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGCGGTTATGCCGATCGCGTCACACTACGCCTGAACGTT  888

Query  874  GAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGG  947
            |||||.|||.|||||||||||||||||||||||||||||||||||||.||||||||||||||||||||||||||
Sbjct  889  GAAAATCCGGAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCAGTGGTTGAACTGCACACCGCCGACGG  962

Query  948  CACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGA  1021
            |||||||||||||||||||||||||||.||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  963  CACGCTGATTGAAGCAGAAGCCTGCGACGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGA  1036

Query 1022  ACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAG  1095
            ||||||||||||||||||||||.|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1037  ACGGCAAGCCGTTGCTGATTCGCGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAG  1110

Query 1096  CAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAA  1169
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1111  CAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAA  1184

Query 1170  CCATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACG  1243
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1185  CCATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACG  1258

Query 1244  GCATGGTGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATG  1317
            ||||||||||||||||||||||||||||||||||||||||||||||.|||||||||||||||||||||||.|||
Sbjct 1259  GCATGGTGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCCGCGATGAGCGAACGCGTAACGCGGATG  1332

Query 1318  GTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCA  1391
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1333  GTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCA  1406

Query 1392  CGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACA  1465
            ||||||||||||||||||||||||||||||||||||||||||||||||.|||||||||||||||||||||||||
Sbjct 1407  CGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGGTACAGTATGAAGGCGGCGGAGCCGACA  1480

Query 1466  CCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAA  1539
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||.|||||||||
Sbjct 1481  CCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCGGTGCCGAAA  1554

Query 1540  TGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGAT  1613
            ||||||||||||||||||||||||||.||||||||.|.||||||||||||||||||||||||.|||||||||||
Sbjct 1555  TGGTCCATCAAAAAATGGCTTTCGCTGCCTGGAGAAATGCGCCCGCTGATCCTTTGCGAATATGCCCACGCGAT  1628

Query 1614  GGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCG  1687
            ||||||||||||||||||.||||||||||||||||||||||||||||||||.||||||||||||||||||||||
Sbjct 1629  GGGTAACAGTCTTGGCGGCTTCGCTAAATACTGGCAGGCGTTTCGTCAGTACCCCCGTTTACAGGGCGGCTTCG  1702

Query 1688  TCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGAT  1761
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1703  TCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGAT  1776

Query 1762  TTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGC  1835
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||.||
Sbjct 1777  TTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCGGC  1850

Query 1836  GCTGACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCG  1909
            |||||||||||||||||||||.|||||||.|||||||||||||||||||||||.||||||||||||||||||||
Sbjct 1851  GCTGACGGAAGCAAAACACCAACAGCAGTATTTCCAGTTCCGTTTATCCGGGCGAACCATCGAAGTGACCAGCG  1924

Query 1910  AATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGC  1983
            |||||||||||||||||||||||||||||.|||||||||||||||||||.||||||||.|||||||||||||||
Sbjct 1925  AATACCTGTTCCGTCATAGCGATAACGAGTTCCTGCACTGGATGGTGGCACTGGATGGCAAGCCGCTGGCAAGC  1998

Query 1984  GGTGAAGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAG  2057
            ||||||||||||||||||||.|..||.||||||||.|||||||||||||||||||||||.||||||||||||||
Sbjct 1999  GGTGAAGTGCCTCTGGATGTTGGCCCGCAAGGTAAGCAGTTGATTGAACTGCCTGAACTGCCGCAGCCGGAGAG  2072

Query 2058  CGCCGGGCAACTCTGGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGCCACATCA  2131
            ||||||.|||||||||||.||.|||||||||||||||||.||||||||||||||||||||||||||.|||||||
Sbjct 2073  CGCCGGACAACTCTGGCTAACGGTACGCGTAGTGCAACCAAACGCGACCGCATGGTCAGAAGCCGGACACATCA  2146

Query 2132  GCGCCTGGCAGCAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCAT  2205
            |||||||||||||.|||||||||||||||||||||||.|||||.||||||.|||||||||||||||||||.||.
Sbjct 2147  GCGCCTGGCAGCAATGGCGTCTGGCGGAAAACCTCAGCGTGACACTCCCCTCCGCGTCCCACGCCATCCCTCAA  2220

Query 2206  CTGACCACCAGCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTT  2279
            |||||||||||||.||.|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2221  CTGACCACCAGCGGAACGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTT  2294

Query 2280  TCTTTCACAGATGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGC  2353
            |||||||||||||||||||||||||.||||||||||||||||.||||||||||||||||||||||||||.||||
Sbjct 2295  TCTTTCACAGATGTGGATTGGCGATGAAAAACAACTGCTGACCCCGCTGCGCGATCAGTTCACCCGTGCGCCGC  2368

Query 2354  TGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCG  2427
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2369  TGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCG  2442

Query 2428  GGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGACGCGGTGCTGATTACGAC  2501
            ||||||||||||||||||||.||||||||||||||||||||||||||||||||.|||||||||||||||||.||
Sbjct 2443  GGCCATTACCAGGCCGAAGCGGCGTTGTTGCAGTGCACGGCAGATACACTTGCCGACGCGGTGCTGATTACAAC  2516

Query 2502  CGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTC  2575
            |||.||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||....|||.
Sbjct 2517  CGCCCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGGCACGGTG  2590

Query 2576  AAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAG  2649
            |.||||..||.|..||.|||||||..|||||.||||||||||||||||||||||||||||||||||.|||||||
Sbjct 2591  AGATGGTCATCAATGTGGATGTTGCGGTGGCAAGCGATACACCGCATCCGGCGCGGATTGGCCTGACCTGCCAG  2664

Query 2650  CTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGC  2723
            |||||||||||..||||||||||||||||||||||..|.|||||||||||||||||||||||||||||||||||
Sbjct 2665  CTGGCGCAGGTCTCAGAGCGGGTAAACTGGCTCGGCCTGGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGC  2738

Query 2724  CGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTC  2797
            .|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2739  AGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTC  2812

Query 2798  TGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGC  2871
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2813  TGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGC  2886

Query 2872  TACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATAT  2945
            |||||.|||||.||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2887  TACAGCCAACAACAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATAT  2960

Query 2946  CGACGGTTTCCATATGGGGATTGGTGGAGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTACAGCTGAGCG  3019
            |||||||||||||||||||||||||||.|||||||||||||||||||||||||||||||||||.||||||||||
Sbjct 2961  CGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCG  3034

Query 3020  CCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAAACTAAGGGTGGGCGCGCCGACCCAGCTTTCTTGTAC  3093
            ||||||||||||||||||||||||||||||||||||||  ||                                
Sbjct 3035  CCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAA--TA--------------------------------  3074

Query 3094  AAAGTGGTTGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGCGGTTCGAAGGTAAGCCTATCCC  3167
                                                                                      
Sbjct 3075  --------------------------------------------------------------------------  3074

Query 3168  TAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGT  3204
                                                 
Sbjct 3075  -------------------------------------  3074