Nucleotide Global Alignment

Description

Query:
BRDN0000464779
Subject:
promegaLuc.1
Aligned Length:
1650
Identities:
1650
Gaps:
0

Alignment

Query    1  ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCA  74
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct    1  ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCA  74

Query   75  ACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGG  148
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct   75  ACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGG  148

Query  149  ACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACA  222
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  149  ACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACA  222

Query  223  AATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGG  296
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  223  AATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGG  296

Query  297  AGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTA  370
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  297  AGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTA  370

Query  371  CCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAA  444
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  371  CCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAA  444

Query  445  ATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACC  518
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  445  ATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACC  518

Query  519  TCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACT  592
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  519  TCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACT  592

Query  593  CCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCATGCC  666
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  593  CCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCATGCC  666

Query  667  AGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTT  740
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  667  AGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTT  740

Query  741  TGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGC  814
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  741  TGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGC  814

Query  815  TGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCTTCTTCGCC  888
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  815  TGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCTTCTTCGCC  888

Query  889  AAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGTGGCGCTCCCCTCTCTAA  962
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  889  AAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGTGGCGCTCCCCTCTCTAA  962

Query  963  GGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTA  1036
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  963  GGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTA  1036

Query 1037  CATCAGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAA  1110
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1037  CATCAGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAA  1110

Query 1111  GCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCC  1184
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1111  GCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCC  1184

Query 1185  TATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATT  1258
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1185  TATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATT  1258

Query 1259  CTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTAC  1332
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1259  CTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTAC  1332

Query 1333  AAAGGCTATCAGGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGT  1406
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1333  AAAGGCTATCAGGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGT  1406

Query 1407  CGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGA  1480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1407  CGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGA  1480

Query 1481  CGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTT  1554
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1481  CGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTT  1554

Query 1555  GTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAA  1628
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1555  GTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAA  1628

Query 1629  GAAGGGCGGAAAGATCGCCGTG  1650
            ||||||||||||||||||||||
Sbjct 1629  GAAGGGCGGAAAGATCGCCGTG  1650