Nucleotide Global Alignment

Description

Query:
BRDN0000464771
Subject:
LacZ.1
Aligned Length:
3207
Identities:
3204
Gaps:
3

Alignment

Query    1  ATGATAGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGC  74
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct    1  ATGATAGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGC  74

Query   75  ACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCC  148
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct   75  ACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCC  148

Query  149  TGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTT  222
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  149  TGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTT  222

Query  223  CCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGT  296
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  223  CCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGT  296

Query  297  GACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTA  370
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  297  GACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTA  370

Query  371  ATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTG  444
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  371  ATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTG  444

Query  445  TGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTT  518
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  445  TGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTT  518

Query  519  ACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGGAGTGACGGCAGTTATCTGGAAGATCAGGATA  592
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  519  ACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGGAGTGACGGCAGTTATCTGGAAGATCAGGATA  592

Query  593  TGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCAT  666
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  593  TGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCAT  666

Query  667  GTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCG  740
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  667  GTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCG  740

Query  741  TGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCG  814
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  741  TGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCG  814

Query  815  GTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTG  888
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  815  GTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTG  888

Query  889  TGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGATTGAAGC  962
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  889  TGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGATTGAAGC  962

Query  963  AGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGC  1036
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  963  AGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGC  1036

Query 1037  TGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAG  1110
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1037  TGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAG  1110

Query 1111  GATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTA  1184
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1111  GATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTA  1184

Query 1185  CACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAATGA  1258
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1185  CACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAATGA  1258

Query 1259  ATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGT  1332
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1259  ATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGT  1332

Query 1333  AATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCG  1406
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1333  AATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCG  1406

Query 1407  CTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATA  1480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1407  CTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATA  1480

Query 1481  TTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAA  1554
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1481  TTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAA  1554

Query 1555  TGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGG  1628
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1555  TGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGG  1628

Query 1629  CGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGG  1702
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1629  CGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGG  1702

Query 1703  ATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCG  1776
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1703  ATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCG  1776

Query 1777  AACGATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAA  1850
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1777  AACGATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAA  1850

Query 1851  ACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTC  1924
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1851  ACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTC  1924

Query 1925  ATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTG  1998
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1925  ATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTG  1998

Query 1999  GATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTG  2072
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1999  GATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTG  2072

Query 2073  GCTCACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGCCACATCAGCGCCTGGCAGCAGT  2146
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2073  GCTCACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGCCACATCAGCGCCTGGCAGCAGT  2146

Query 2147  GGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAA  2220
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2147  GGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAA  2220

Query 2221  ATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTG  2294
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2221  ATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTG  2294

Query 2295  GATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTG  2368
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2295  GATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTG  2368

Query 2369  GCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCC  2442
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2369  GCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCC  2442

Query 2443  GAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGACGCGGTGCTGATTACGACCGCTCACGCGTGGCA  2516
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2443  GAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGACGCGGTGCTGATTACGACCGCTCACGCGTGGCA  2516

Query 2517  GCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCG  2590
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2517  GCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCG  2590

Query 2591  TTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCA  2664
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2591  TTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCA  2664

Query 2665  GAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCG  2738
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2665  GAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCG  2738

Query 2739  CTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGC  2812
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2739  CTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGC  2812

Query 2813  GCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAA  2886
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2813  GCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAA  2886

Query 2887  CTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATAT  2960
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2887  CTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATAT  2960

Query 2961  GGGGATTGGTGGAGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTACAGCTGAGCGCCGGTCGCTACCATT  3034
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2961  GGGGATTGGTGGAGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTACAGCTGAGCGCCGGTCGCTACCATT  3034

Query 3035  ACCAGTTGGTCTGGTGTCAAAAAACTAAGGGTGGGCGCGCCGACCCAGCTTTCTTGTACAAAGTGGTTGATATC  3108
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 3035  ACCAGTTGGTCTGGTGTCAAAAAACTAAGGGTGGGCGCGCCGACCCAGCTTTCTTGTACAAAGTGGTTGATATC  3108

Query 3109  CAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGCGGTTCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGG  3182
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 3109  CAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGCGGTTCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGG  3182

Query 3183  TCTCGATTCTACGCGTACCGGT---  3204
            ||||||||||||||||||||||   
Sbjct 3183  TCTCGATTCTACGCGTACCGGTTTG  3207