Introductory Materials
Read this first to get started with the GATK


 

View by:

 

Level

 



This document explains the concepts involved and how they are applied within the GATK (and Queue where applicable). For specific configuration recommendations, see the companion document on parallelizing GATK tools.

1. Introducing the concept of parallelism

Parallelism is a way to make a program finish faster by performing several operations in parallel, rather than sequentially (i.e. waiting for each operation to finish before starting the next one).

Imagine you need to cook rice for sixty-four people, but your rice cooker can only make enough rice for four people at a time. If you have to cook all the batches of rice sequentially, it's going to take all night. But if you have eight rice cookers that you can use in parallel, you can finish up to eight times faster.

This is a very simple idea but it has a key requirement: you have to be able to break down the job into smaller tasks that can be done independently. It's easy enough to divide portions of rice because rice itself is a collection of discrete units. In contrast, let's look at a case where you can't make that kind of division: it takes one pregnant woman nine months to grow a baby, but you can't do it in one month by having nine women share the work.

The good news is that most GATK runs are more like rice than like babies. Because GATK tools are built to use the Map/Reduce method (see doc for details), most GATK runs essentially consist of a series of many small independent operations that can be parallelized.

A quick warning about tradeoffs

Parallelism is a great way to speed up processing on large amounts of data, but it has "overhead" costs. Without getting too technical at this point, let's just say that parallelized jobs need to be managed, you have to set aside memory for them, regulate file access, collect results and so on. So it's important to balance the costs against the benefits, and avoid dividing the overall work into too many small jobs.

Going back to the introductory example, you wouldn't want to use a million tiny rice cookers that each boil a single grain of rice. They would take way too much space on your countertop, and the time it would take to distribute each grain then collect it when it's cooked would negate any benefits from parallelizing in the first place.

Parallel computing in practice (sort of)

OK, parallelism sounds great (despite the tradeoffs caveat), but how do we get from cooking rice to executing programs? What actually happens in the computer?

Consider that when you run a program like the GATK, you're just telling the computer to execute a set of instructions.

Let's say we have a text file and we want to count the number of lines in it. The set of instructions to do this can be as simple as:

  • open the file, count the number of lines in the file, tell us the number, close the file

Note that tell us the number can mean writing it to the console, or storing it somewhere for use later on.

Now let's say we want to know the number of words on each line. The set of instructions would be:

  • open the file, read the first line, count the number of words, tell us the number, read the second line, count the number of words, tell us the number, read the third line, count the number of words, tell us the number

And so on until we've read all the lines, and finally we can close the file. It's pretty straightforward, but if our file has a lot of lines, it will take a long time, and it will probably not use all the computing power we have available.

So to parallelize this program and save time, we just cut up this set of instructions into separate subsets like this:

  • open the file, index the lines

  • read the first line, count the number of words, tell us the number

  • read the second line, count the number of words, tell us the number
  • read the third line, count the number of words, tell us the number
  • [repeat for all lines]

  • collect final results and close the file

Here, the read the Nth line steps can be performed in parallel, because they are all independent operations.

You'll notice that we added a step, index the lines. That's a little bit of peliminary work that allows us to perform the read the Nth line steps in parallel (or in any order we want) because it tells us how many lines there are and where to find each one within the file. It makes the whole process much more efficient. As you may know, the GATK requires index files for the main data files (reference, BAMs and VCFs); the reason is essentially to have that indexing step already done.

Anyway, that's the general principle: you transform your linear set of instructions into several subsets of instructions. There's usually one subset that has to be run first and one that has to be run last, but all the subsets in the middle can be run at the same time (in parallel) or in whatever order you want.

2. Parallelizing the GATK

There are three different modes of parallelism offered by the GATK, and to really understand the difference you first need to understand what are the different levels of computing that are involved.

A quick word about levels of computing

By levels of computing, we mean the computing units in terms of hardware: the core, the machine (or CPU) and the cluster.

  • Core: the level below the machine. On your laptop or desktop, the CPU (central processing unit, or processor) contains one or more cores. If you have a recent machine, your CPU probably has at least two cores, and is therefore called dual-core. If it has four, it's a quad-core, and so on. High-end consumer machines like the latest Mac Pro have up to twelve-core CPUs (which should be called dodeca-core if we follow the Latin terminology) but the CPUs on some professional-grade machines can have tens or hundreds of cores.

  • Machine: the middle of the scale. For most of us, the machine is the laptop or desktop computer. Really we should refer to the CPU specifically, since that's the relevant part that does the processing, but the most common usage is to say machine. Except if the machine is part of a cluster, in which case it's called a node.

  • Cluster: the level above the machine. This is a high-performance computing structure made of a bunch of machines (usually called nodes) networked together. If you have access to a cluster, chances are it either belongs to your institution, or your company is renting time on it. A cluster can also be called a server farm or a load-sharing facility.

Parallelism can be applied at all three of these levels, but in different ways of course, and under different names. Parallelism takes the name of multi-threading at the core and machine levels, and scatter-gather at the cluster level.

Multi-threading

In computing, a thread of execution is a set of instructions that the program issues to the processor to get work done. In single-threading mode, a program only sends a single thread at a time to the processor and waits for it to be finished before sending another one. In multi-threading mode, the program may send several threads to the processor at the same time.

Not making sense? Let's go back to our earlier example, in which we wanted to count the number of words in each line of our text document. Hopefully it is clear that the first version of our little program (one long set of sequential instructions) is what you would run in single-threaded mode. And the second version (several subsets of instructions) is what you would run in multi-threaded mode, with each subset forming a separate thread. You would send out the first thread, which performs the preliminary work; then once it's done you would send the "middle" threads, which can be run in parallel; then finally once they're all done you would send out the final thread to clean up and collect final results.

If you're still having a hard time visualizing what the different threads are like, just imagine that you're doing cross-stitching. If you're a regular human, you're working with just one hand. You're pulling a needle and thread (a single thread!) through the canvas, making one stitch after another, one row after another. Now try to imagine an octopus doing cross-stitching. He can make several rows of stitches at the same time using a different needle and thread for each. Multi-threading in computers is surprisingly similar to that.

Hey, if you have a better example, let us know in the forum and we'll use that instead.

Alright, now that you understand the idea of multithreading, let's get practical: how do we do get the GATK to use multi-threading?

There are two options for multi-threading with the GATK, controlled by the arguments -nt and -nct, respectively. They can be combined, since they act at different levels of computing:

  • -nt / --num_threads controls the number of data threads sent to the processor (acting at the machine level)

  • -nct / --num_cpu_threads_per_data_thread controls the number of CPU threads allocated to each data thread (acting at the core level).

Not all GATK tools can use these options due to the nature of the analyses that they perform and how they traverse the data. Even in the case of tools that are used sequentially to perform a multi-step process, the individual tools may not support the same options. For example, at time of writing (Dec. 2012), of the tools involved in local realignment around indels, RealignerTargetCreator supports -nt but not -nct, while IndelRealigner does not support either of these options.

In addition, there are some important technical details that affect how these options can be used with optimal results. Those are explained along with specific recommendations for the main GATK tools in a companion document on parallelizing the GATK.

Scatter-gather

If you Google it, you'll find that the term scatter-gather can refer to a lot of different things, including strategies to get the best price quotes from online vendors, methods to control memory allocation and… an indie-rock band. What all of those things have in common (except possibly the band) is that they involve breaking up a task into smaller, parallelized tasks (scattering) then collecting and integrating the results (gathering). That should sound really familiar to you by now, since it's the general principle of parallel computing.

So yes, "scatter-gather" is really just another way to say we're parallelizing things. OK, but how is it different from multithreading, and why do we need yet another name?

As you know by now, multithreading specifically refers to what happens internally when the program (in our case, the GATK) sends several sets of instructions to the processor to achieve the instructions that you originally gave it in a single command-line. In contrast, the scatter-gather strategy as used by the GATK involves a separate program, called Queue, which generates separate GATK jobs (each with its own command-line) to achieve the instructions given in a so-called Qscript (i.e. a script written for Queue in a programming language called Scala).

At the simplest level, the Qscript can involve a single GATK tool*. In that case Queue will create separate GATK commands that will each run that tool on a portion of the input data (= the scatter step). The results of each run will be stored in temporary files. Then once all the runs are done, Queue will collate all the results into the final output files, as if the tool had been run as a single command (= the gather step).

Note that Queue has additional capabilities, such as managing the use of multiple GATK tools in a dependency-aware manner to run complex pipelines, but that is outside the scope of this article. To learn more about pipelining the GATK with Queue, please see the Queue documentation.

Compare and combine

So you see, scatter-gather is a very different process from multi-threading because the parallelization happens outside of the program itself. The big advantage is that this opens up the upper level of computing: the cluster level. Remember, the GATK program is limited to dispatching threads to the processor of the machine on which it is run – it cannot by itself send threads to a different machine. But Queue can dispatch scattered GATK jobs to different machines in a computing cluster by interfacing with your cluster's job management software.

That being said, multithreading has the great advantage that cores and machines all have access to shared machine memory with very high bandwidth capacity. In contrast, the multiple machines on a network used for scatter-gather are fundamentally limited by network costs.

The good news is that you can combine scatter-gather and multithreading: use Queue to scatter GATK jobs to different nodes on your cluster, then use the GATK's internal multithreading capabilities to parallelize the jobs running on each node.

Going back to the rice-cooking example, it's as if instead of cooking the rice yourself, you hired a catering company to do it for you. The company assigns the work to several people, who each have their own cooking station with multiple rice cookers. Now you can feed a lot more people in the same amount of time! And you don't even have to clean the dishes.

Introduction

1. The basic workflow

Our current best practice for making SNP and indel calls is divided into four sequential steps: initial mapping, refinement of the initial reads, multi-sample indel and SNP calling, and finally variant quality score recalibration. These steps are the same for targeted resequencing, whole exomes, deep whole genomes, and low-pass whole genomes.

Example commands for each tool are available on the individual tool's wiki entry. There is also a list of which resource files to use with which tool.

Note that due to the specific attributes of a project the specific values used in each of the commands may need to be selected/modified by the analyst. Care should be taken by the analyst running our tools to understand what each parameter does and to evaluate which value best fits the data and project design.

2. Lane, Library, Sample, Cohort

There are four major organizational units for next-generation DNA sequencing processes that used throughout this documentation:

  • Lane: The basic machine unit for sequencing. The lane reflects the basic independent run of an NGS machine. For Illumina machines, this is the physical sequencing lane.
  • Library: A unit of DNA preparation that at some point is physically pooled together. Multiple lanes can be run from aliquots from the same library. The DNA library and its preparation is the natural unit that is being sequenced. For example, if the library has limited complexity, then many sequences are duplicated and will result in a high duplication rate across lanes.
  • Sample: A single individual, such as human CEPH NA12878. Multiple libraries with different properties can be constructed from the original sample DNA source. Here we treat samples as independent individuals whose genome sequence we are attempting to determine. From this perspective, tumor / normal samples are different despite coming from the same individual.
  • Cohort: A collection of samples being analyzed together. This organizational unit is the most subjective and depends intimately on the design goals of the sequencing project. For population discovery projects like the 1000 Genomes, the analysis cohort is the ~100 individual in each population. For exome projects with many samples (e.g., ESP with 800 EOMI samples) deeply sequenced we divide up the complete set of samples into cohorts of ~50 individuals for multi-sample analyses.

This document describes how to call variation within a single analysis cohort, comprised for one or many samples, each of one or many libraries that were sequenced on at least one lane of an NGS machine.

Note that many GATK commands can be run at the lane level, but will give better results seeing all of the data for a single sample, or even all of the data for all samples. Unfortunately, there's a trade-off in computational cost by running these commands across all of your data simultaneously.

3. Testing data: 64x HiSeq on chr20 for NA12878

In order to help individuals get up to speed, evaluate their command lines, and generally become familiar with the GATK tools we recommend you download the raw and realigned, recalibrated NA12878 test data from the GATK resource bundle. It should be possible to apply all of the approaches outlined below to get excellent results for realignment, recalibration, SNP calling, indel calling, filtering, and variant quality score recalibration using this data.

4. Where can I find out more about the new GATK 2.0 tools you are talking about?

In our GATK 2.0 slide archive.


Phase I: Raw data processing

1. Raw FASTQs to raw reads via mapping

The GATK data processing pipeline assumes that one of the many NGS read aligners (see this review) has been applied to your raw FASTQ files. For Illumina data we recommend BWA because it is accurate, fast, well-supported, open-source, and emits SAM files natively (which are then easy to convert to BAM).

2. Raw reads to analysis-ready reads

The three key processes used here are:

  • Local realignment around indels: Reads that align on the edges of indels often get mapped with mismatching bases that might look like evidence for SNPs. We look for the most consistent placement of the reads with respect to the indel in order to clean up these artifacts.
  • MarkDuplicates: Duplicately sequenced molecules shouldn't be counted as additional evidence for or against a putative variant. By marking these reads as duplicates the algorithms in the GATK know to ignore them.
  • Base quality score recalibration: The per-base estimate of error known as the base quality score is the foundation upon which all statistically calling algorithms are based. We've found that the estimates provided by the sequencing machines are often inaccurate, and worse, biased. Through recalibration an empirically accurate error model is assigned to the bases to create an analysis-ready bam file. Note: if you have old data that has been recalibrated with an old version of BQSR, you need to rerun your data with the new version so insertion and deletion qualities can be added to your recalibrated BAM file.

There are several options here from the easy and fast basic protocol to the more comprehensive but computationally expensive pipeline. For example, there are two types of realignment which constitute a vastly different amount of processing power required:

  • Realignment only at known sites, which is very efficient, can operate with little coverage (1x per lane genome wide) but can only realign reads at known indels.
  • Fully local realignment uses mismatching bases to determine if a site should be realigned, and relies on sufficient coverage to discover the correct indel allele in the reads for alignment. It is much slower (involves SW step) but can discover new indel sites in the reads. If you have a database of known indels (for human, this database is extensive) then at this stage you would also include these indels during realignment, which vastly improves sensitivity, specificity, and speed.

Fast: lane-level realignment (at known sites only) and lane-level recalibration

This protocol uses lane-level local realignment around known indels (very fast, as there's no sample level processing) to clean up lane-level alignments. This results in better quality scores, as they are less biased for indel alignment artefacts.

for each lane.bam
    dedup.bam <- MarkDuplicate(lane.bam)
    realigned.bam <- realign(dedup.bam) [at only known sites, if possible, otherwise skip]
    recal.bam <- recal(realigned.bam)

Fast + per-sample processing

Here we are essentially just merging the recalibrated lane.bams for a sample, dedupping the reads, and calling it quite. It doesn't perform indel realignment across lanes, so it leaves in some indels artifacts. For humans, which now have an extensive list of indels (get them from the GATK bundle!) the lane-level realignment around known indels is going to make up for the lack of cross-lane realignment. This protocol is appropriate if you are going to use callers like the HaplotypeCaller, UnifiedGenotyper with BAQ, or samtools with BAQ that are less sensitive to the initial alignment of reads, or if your project has limited coverage per sample (< 8x) where per-sample indel realignment isn't more empowered than per-lane realignment. For other situations or for organisms with limited database of segregating indels, it's better to use the advanced protocol if you have deep enough data per sample.

for each sample
    recals.bam <- merged lane-level recal.bams for sample
    dedup.bam <- MarkDuplicates(recals.bam)
    sample.bam <- dedup.bam

Better: recalibration per lane then per-sample realignment with known indels

As with the basic protocol, this protocol assumes the per-lane processing has been already completed. This protocol is essentially the basic protocol but with per-sample indel realignment.

for each sample
    recals.bam <- merged lane-level recal.bams for sample
    dedup.bam <- MarkDuplicates(recals.bam)
    realigned.bam <- realign(dedup.bam) [with known sites included if available]
    sample.bam <- realigned.bam

This is the protocol we use at the Broad in our fully automated pipeline because it gives an optimal balance of performance, accuracy and convenience.

Best: per-sample realignment with known indels then recalibration

Rather than doing the lane level cleaning and recalibration, this process aggregates all of the reads for each sample and then does a full dedupping, realign, and recalibration, yielding the best single-sample results. The big change here is sample-level cleaning followed by recalibration, giving you the most accurate quality scores possible for a single sample.

for each sample
    lanes.bam <- merged lane.bams for sample
    dedup.bam <- MarkDuplicates(lanes.bam)
    realigned.bam <- realign(dedup.bam) [with known sites included if available]
    recal.bam <- recal(realigned.bam)
    sample.bam <- recal.bam

This protocol can be hard to implement in practice unless you can afford to wait until all of the data is available to do data processing for your samples.

Misc. notes on the process

  • MarkDuplicates needs only be run at the library level. So the sample-level dedupping isn't necessary if you only ever have a library on a single lane. If you run the sample library on many lanes (as can be necessary for whole exome, for example), you should dedup at the library level.
  • The base quality score recalibrator is read group aware, so running it on a merged BAM files containing multiple read groups is the same as running it on each bam file individually. There's some memory cost (so it's best not to recalibrate many read groups simultaneously) but for reasonable projects this is fine.
  • Local realignment preserves read meta-data, so you can realign and then recalibrate just fine.
  • Multi-sample realignment with known sites and recalibration isn't really recommended any longer. It's extremely computational expensive and isn't necessary for advanced callers with advanced filters like the Unified Genotyper / HaplotypeCaller and VQSR. It's better to use one of the protocols above and then an advanced caller that is robust to indel artifacts.
  • However, note that for contrastive calling projects -- such as cancer tumor/normals -- we recommend realigning both the tumor and the normal together in general to avoid slight alignment differences between the two tissue types.

3. Reducing BAMs to minimize file sizes and improve calling performance

ReduceReads is a novel (perhaps even breakthrough?) GATK 2.0 data compression algorithm. The purpose of ReducedReads is to take a BAM file with NGS data and reduce it down to just the information necessary to make accurate SNP and indel calls, as well as genotype reference sites (hard to achieve) using GATK tools like UnifiedGenotyper or HaplotypeCaller. ReduceReads accepts as an input a BAM file and produces a valid BAM file (it works in IGV!) but with a few extra tags that the GATK can use to make accurate calls.

You can find more information about reduced reads in some of our presentations in the archive.

ReduceReads works well for exomes or high-coverage (at least 20x average coverage) whole genome BAM files. In this case we highly recommend using ReduceReads to minimize the file sizes. Note that ReduceReads performs a lossy compression of the sequencing data that works well with the downstream GATK tools, but may not be supported by external tools. Also, we recommend that you archive your original BAM file, or at least a copy of your original FASTQs, as ReduceReads is highly lossy and doesn't quality as an archive data compression format.

Using ReduceReads on your BAM files will cut down the sizes to approximately 1/100 of their original sizes, allowing the GATK to process tens of thousands of samples simultaneously without excessive IO and processing burdens. Even for single samples ReduceReads cuts the memory requirements, IO burden, and CPU costs of downstream tools significantly (10x or more) and so we recommend you preprocess analysis-ready BAM files with ReducedReads.

for each sample
    sample.reduced.bam <- ReduceReads(sample.bam)

Phase II: Initial variant discovery and genotyping

1. Input BAMs for variant discovery and genotyping

After the raw data processing step, the GATK variant detection process assumes that you have aligned, duplicate marked, and recalibrated BAM files for all of the samples in your cohort. Because the GATK can dynamically merge BAM files, it isn't critical to have merged files by lane into sample bams, or even samples bams into cohort bams. In general we try to create sample level bams for deep data sets (deep WG or exomes) and merged cohort files by chromosome for WG low-pass.

For this part of the this document, I'm going to assume that you have a single realigned, recalibrated, dedupped BAM per sample, called sampleX.bam, for X from 1 to N samples in your cohort. Note that some of the data processing steps, such as multiple sample local realignment, will merge BAMS for many samples into a single BAM. If you've gone down this route, you just need to modify the GATK commands as necessary to take not multiple BAMs, one for each sample, but a single BAM for all samples.

2. Multi-sample SNP and indel calling

The next step in the standard GATK data processing pipeline, whole genome or targeted, deep or shallow, is to apply the Haplotype Caller or Unified Genotyper to identify sites among the cohort samples that are statistically non-reference. This will produce a multi-sample VCF file, with sites discovered across samples and genotypes assigned to each sample in the cohort. It's in this stage that we use the meta-data in the BAM files extensively -- read groups for reads, with samples, platforms, etc -- to enable us to do the multi-sample merging and genotyping correctly. It was a pain for data processing, yes, but now life is easy for downstream calling and analysis.

Selecting an appropriate quality score threshold

A common question is the confidence score threshold to use for variant detection. We recommend:

  • Deep (> 10x coverage per sample) data: we recommend a minimum confidence score threshold of Q30.
  • Shallow (< 10x coverage per sample) data: because variants have by necessity lower quality with shallower coverage we recommend a minimum confidence score of Q4 in projects with 100 samples or fewer and Q10 otherwise.

Standard protocol: HaplotypeCaller

raw.vcf <- HaplotypeCaller(sample1.bam, sample2.bam, ..., sampleN.bam)

Standard protocol: UnifiedGenotyper

raw.vcf <- UnifiedGenotyper(sample1.bam, sample2.bam, ..., sampleN.bam)

Choosing HaplotypeCaller or UnifiedGenotyper

  • We believe the best possible caller in the GATK is the HaplotypeCaller, which combines a local de novo assembler with a more advanced HMM likelihood function than the UnifiedGenotyper. It should produce excellent SNP, MNP, indel, and short SV calls. It should be the go-to calling algorithm for most projects. It is, for example, how we make our Phase II call set for 1000 Genomes.
  • Currently the HaplotypeCaller only supports diploid calling. If you want to call non-diploid samples you'll need to use the UnifiedGenotyper.
  • At the moment the HaplotypeCaller does not support multithreading. For now you should indeed stick with the UG if you wish to use the -nt option. However you can use Queue to parallelize execution of HaplotypeCaller.
  • If for some reason you cannot use the HaplotyperCaller do fall back to the UnifiedGenotyper protocol below. Otherwise try out the HaplotypeCaller and let us know about your experiences here on the forum!

Phase III: Integrating analyses: getting the best call set possible

This raw VCF file should be as sensitive to variation as you'll get without imputation. At this stage, you can assess things like sensitivity to known variant sites or genotype chip concordance. The problem is that the raw VCF will have many sites that aren't really genetic variants but are machine artifacts that make the site statistically non-reference. All of the subsequent steps are designed to separate out the false positive machine artifacts from the true positive genetic variants.

1. Statistical filtering of the raw calls

The process used here is the Variant quality score recalibrator which builds an adaptive error model using known variant sites and then applies this model to estimate the probability that each variant in the callset is a true genetic variant or a machine/alignment artifact. All filtering criteria are learned from the data itself.

2. Analysis ready VCF protocol

Take a look at our FAQ page for specific recommendations on which training sets and command-line arguments to use with various project designs. It is expected that analysis will be required by the user when determining the best way to use this tool for different projects. These recommendations are only meant as jumping off points!

We've found that the best results are obtained with the VQSR when it is used to build separate adaptive error models for SNPs versus INDELs:

    snp.model <- BuildErrorModelWithVQSR(raw.vcf, SNP)
    indel.model <- BuildErrorModelWithVQSR(raw.vcf, INDEL)
    recalibratedSNPs.rawIndels.vcf <- ApplyRecalibration(raw.vcf, snp.model, SNP)
    analysisReady.vcf <- ApplyRecalibration(recalibratedSNPs.rawIndels.vcf, indel.model, INDEL)

3. Notes about small whole exome projects or small target experiments

In our testing we've found that in order to achieve the best exome results one needs to use an exome callset with at least 30 samples. Also, for experiments that employ targeted resequencing of a small region (for example, a few hundred genes), VQSR may not be empowered regardless of the number of samples in the experiment. For users with experiments containing fewer exome samples or with a small target region there are several options to explore (listed in priority order of what we think will give the best results):

  • Add additional samples for variant calling, either by sequencing additional samples or using publicly available exome bams from the 1000 Genomes Project (this option is used by the Broad exome production pipeline).
  • Use the VQSR with the smaller SNP callset but experiment with the argument settings. For example, try adding --maxGaussians 4 --percentBad 0.05 to your command line. Note that this is very dependent on your dataset, and you may need to try some very different settings. It may even not work at all. Unfortunately we cannot give you any specific advice, so please do not post questions on the forum asking for help finding the right parameters.
  • Use hard filters (detailed below).

Recommendations for very small data sets (in terms of both number of samples or size of targeted regions)

These recommended arguments for VariantFiltration are only to used when ALL other options are not available:

You will need to compose filter expressions (see here, here and here for details) to filter on the following annotations and values:

For SNPs:

  • QD < 2.0
  • MQ < 40.0
  • FS > 60.0
  • HaplotypeScore > 13.0
  • MQRankSum < -12.5
  • ReadPosRankSum < -8.0

For indels:

  • QD < 2.0
  • ReadPosRankSum < -20.0
  • InbreedingCoeff < -0.8
  • FS > 200.0

Note that the InbreedingCoeff statistic is a population-level calculation that is only available with 10 or more samples. If you have fewer samples you will need to omit that particular filter statement.

For shallow-coverage (<10x): you cannot use filtering to reliably separate true positives from false positives. You must use the protocol involving variant quality score recalibration.

The maximum DP (depth) filter only applies to whole genome data, where the probability of a site having exactly N reads given an average coverage of M is a well-behaved function. First principles suggest this should be a binomial sampling but in practice it is more a Gaussian distribution. Regardless, the DP threshold should be set a 5 or 6 sigma from the mean coverage across all samples, so that the DP > X threshold eliminates sites with excessive coverage caused by alignment artifacts. Note that for exomes, a straight DP filter shouldn't be used because the relationship between misalignments and depth isn't clear for capture data.

That said, all of the caveats about determining the right parameters, etc, are annoying and are largely eliminated by variant quality score recalibration.

The GATK uses two files to access and safety check access to the reference files: a .dict dictionary of the contig names and sizes and a .fai fasta index file to allow efficient random access to the reference bases. You have to generate these files in order to be able to use a Fasta file as reference.

NOTE: Picard and samtools treat spaces in contig names differently. We recommend that you avoid using spaces in contig names.

Creating the fasta sequence dictionary file

We use CreateSequenceDictionary.jar from Picard to create a .dict file from a fasta file.

> java -jar CreateSequenceDictionary.jar R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:11 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:58 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary done.
Runtime.totalMemory()=2112487424
44.922u 2.308s 0:47.09 100.2%   0+0k 0+0io 2pf+0w

This produces a SAM-style header file describing the contents of our fasta file.

> cat Homo_sapiens_assembly18.dict 
@HD     VN:1.0  SO:unsorted
@SQ     SN:chrM LN:16571        UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d2ed829b8a1628d16cbeee88e88e39eb
@SQ     SN:chr1 LN:247249719    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9ebc6df9496613f373e73396d5b3b6b6
@SQ     SN:chr2 LN:242951149    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:b12c7373e3882120332983be99aeb18d
@SQ     SN:chr3 LN:199501827    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0e48ed7f305877f66e6fd4addbae2b9a
@SQ     SN:chr4 LN:191273063    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cf37020337904229dca8401907b626c2
@SQ     SN:chr5 LN:180857866    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:031c851664e31b2c17337fd6f9004858
@SQ     SN:chr6 LN:170899992    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfe8005c536131276d448ead33f1b583
@SQ     SN:chr7 LN:158821424    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:74239c5ceee3b28f0038123d958114cb
@SQ     SN:chr8 LN:146274826    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1eb00fe1ce26ce6701d2cd75c35b5ccb
@SQ     SN:chr9 LN:140273252    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:ea244473e525dde0393d353ef94f974b
@SQ     SN:chr10        LN:135374737    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4ca41bf2d7d33578d2cd7ee9411e1533
@SQ     SN:chr11        LN:134452384    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:425ba5eb6c95b60bafbf2874493a56c3
@SQ     SN:chr12        LN:132349534    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d17d70060c56b4578fa570117bf19716
@SQ     SN:chr13        LN:114142980    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c4f3084a20380a373bbbdb9ae30da587
@SQ     SN:chr14        LN:106368585    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c1ff5d44683831e9c7c1db23f93fbb45
@SQ     SN:chr15        LN:100338915    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:5cd9622c459fe0a276b27f6ac06116d8
@SQ     SN:chr16        LN:88827254     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3e81884229e8dc6b7f258169ec8da246
@SQ     SN:chr17        LN:78774742     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2a5c95ed99c5298bb107f313c7044588
@SQ     SN:chr18        LN:76117153     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3d11df432bcdc1407835d5ef2ce62634
@SQ     SN:chr19        LN:63811651     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2f1a59077cfad51df907ac25723bff28
@SQ     SN:chr20        LN:62435964     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f126cdf8a6e0c7f379d618ff66beb2da
@SQ     SN:chr21        LN:46944323     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f1b74b7f9f4cdbaeb6832ee86cb426c6
@SQ     SN:chr22        LN:49691432     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2041e6a0c914b48dd537922cca63acb8
@SQ     SN:chrX LN:154913754    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d7e626c80ad172a4d7c95aadb94d9040
@SQ     SN:chrY LN:57772954     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:62f69d0e82a12af74bad85e2e4a8bd91
@SQ     SN:chr1_random  LN:1663265      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cc05cb1554258add2eb62e88c0746394
@SQ     SN:chr2_random  LN:185571       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:18ceab9e4667a25c8a1f67869a4356ea
@SQ     SN:chr3_random  LN:749256       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cc571e918ac18afa0b2053262cadab6
@SQ     SN:chr4_random  LN:842648       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cab2949ccf26ee0f69a875412c93740
@SQ     SN:chr5_random  LN:143687       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:05926bdbff978d4a0906862eb3f773d0
@SQ     SN:chr6_random  LN:1875562      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d62eb2919ba7b9c1d382c011c5218094
@SQ     SN:chr7_random  LN:549659       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:28ebfb89c858edbc4d71ff3f83d52231
@SQ     SN:chr8_random  LN:943810       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0ed5b088d843d6f6e6b181465b9e82ed
@SQ     SN:chr9_random  LN:1146434      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1e3d2d2f141f0550fa28a8d0ed3fd1cf
@SQ     SN:chr10_random LN:113275       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:50be2d2c6720dabeff497ffb53189daa
@SQ     SN:chr11_random LN:215294       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfc93adc30c621d5c83eee3f0d841624
@SQ     SN:chr13_random LN:186858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:563531689f3dbd691331fd6c5730a88b
@SQ     SN:chr15_random LN:784346       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bf885e99940d2d439d83eba791804a48
@SQ     SN:chr16_random LN:105485       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:dd06ea813a80b59d9c626b31faf6ae7f
@SQ     SN:chr17_random LN:2617613      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:34d5e2005dffdfaaced1d34f60ed8fc2
@SQ     SN:chr18_random LN:4262 UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f3814841f1939d3ca19072d9e89f3fd7
@SQ     SN:chr19_random LN:301858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:420ce95da035386cc8c63094288c49e2
@SQ     SN:chr21_random LN:1679693      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:a7252115bfe5bb5525f34d039eecd096
@SQ     SN:chr22_random LN:257318       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4f2d259b82f7647d3b668063cf18378b
@SQ     SN:chrX_random  LN:1719168      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f4d71e0758986c15e5455bf3e14e5d6f

Creating the fasta index file

We use the faidx command in samtools to prepare the fasta index file. This file describes byte offsets in the fasta file for each contig, allowing us to compute exactly where a particular reference base at contig:pos is in the fasta file.

> samtools faidx Homo_sapiens_assembly18.fasta 
108.446u 3.384s 2:44.61 67.9%   0+0k 0+0io 0pf+0w

This produces a text file with one record per line for each of the fasta contigs. Each record is of the: contig, size, location, basesPerLine, bytesPerLine. The index file produced above looks like:

> cat Homo_sapiens_assembly18.fasta.fai 
chrM    16571   6       50      51
chr1    247249719       16915   50      51
chr2    242951149       252211635       50      51
chr3    199501827       500021813       50      51
chr4    191273063       703513683       50      51
chr5    180857866       898612214       50      51
chr6    170899992       1083087244      50      51
chr7    158821424       1257405242      50      51
chr8    146274826       1419403101      50      51
chr9    140273252       1568603430      50      51
chr10   135374737       1711682155      50      51
chr11   134452384       1849764394      50      51
chr12   132349534       1986905833      50      51
chr13   114142980       2121902365      50      51
chr14   106368585       2238328212      50      51
chr15   100338915       2346824176      50      51
chr16   88827254        2449169877      50      51
chr17   78774742        2539773684      50      51
chr18   76117153        2620123928      50      51
chr19   63811651        2697763432      50      51
chr20   62435964        2762851324      50      51
chr21   46944323        2826536015      50      51
chr22   49691432        2874419232      50      51
chrX    154913754       2925104499      50      51
chrY    57772954        3083116535      50      51
chr1_random     1663265 3142044962      50      51
chr2_random     185571  3143741506      50      51
chr3_random     749256  3143930802      50      51
chr4_random     842648  3144695057      50      51
chr5_random     143687  3145554571      50      51
chr6_random     1875562 3145701145      50      51
chr7_random     549659  3147614232      50      51
chr8_random     943810  3148174898      50      51
chr9_random     1146434 3149137598      50      51
chr10_random    113275  3150306975      50      51
chr11_random    215294  3150422530      50      51
chr13_random    186858  3150642144      50      51
chr15_random    784346  3150832754      50      51
chr16_random    105485  3151632801      50      51
chr17_random    2617613 3151740410      50      51
chr18_random    4262    3154410390      50      51
chr19_random    301858  3154414752      50      51
chr21_random    1679693 3154722662      50      51
chr22_random    257318  3156435963      50      51
chrX_random     1719168 3156698441      50      51

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##fileformat=VCFv4.0
##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
#CHROM  POS ID      REF ALT QUAL    FILTER  INFO    FORMAT  NA12878
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

[HEADER LINES]
#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence (GQ=25.92) isn't so good, largely because there were only a total of 4 reads at this site (DP=4), 1 of which was ref (=had the reference base) and 3 of which were alt (=had the alternate base) (AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value), whereas there's a serious chance that the subject is hom-var (=homozygous with the variant allele) since PL(1/1) = 26 = 10^(-2.6) = 0.25%. Either way, though, it's clear that the subject is definitely not home-ref (=homozygous with the reference allele) here since PL(0/0) = 103 = 10^(-10.3) which is a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).

Objective

Run a basic analysis command on example data, parallelized with Queue.

Prerequisites

Steps

  1. Set up a dry run of Queue
  2. Run the analysis for real
  3. Running on a computing farm

1. Set up a dry run of Queue

One very cool feature of Queue is that you can test your script by doing a "dry run". That means Queue will prepare the analysis and build the scatter commands, but not actually run them. This makes it easier to check the sanity of your script and command.

Here we're going to set up a dry run of a CountReads analysis. You should be familiar with the CountReads walker and the example files from the bundles, as used in the basic "GATK for the first time" tutorial. In addition, we're going to use the example QScript called ExampleCountReads.scala provided in the Queue package download.

Action

Type the following command:

java -Djava.io.tmpdir=tmp -jar Queue.jar -S ExampleCountReads.scala -R exampleFASTA.fasta -I exampleBAM.bam

where -S ExampleCountReads.scala specifies which QScript we want to run, -R exampleFASTA.fasta specifies the reference sequence, and -I exampleBAM.bam specifies the file of aligned reads we want to analyze.

Expected Result

After a few seconds you should see output that looks nearly identical to this:

INFO  00:30:45,527 QScriptManager - Compiling 1 QScript 
INFO  00:30:52,869 QScriptManager - Compilation complete 
INFO  00:30:53,284 HelpFormatter - ---------------------------------------------------------------------- 
INFO  00:30:53,284 HelpFormatter - Queue v2.0-36-gf5c1c1a, Compiled 2012/08/08 20:18:21 
INFO  00:30:53,284 HelpFormatter - Copyright (c) 2012 The Broad Institute 
INFO  00:30:53,284 HelpFormatter - Fro support and documentation go to http://www.broadinstitute.org/gatk 
INFO  00:30:53,285 HelpFormatter - Program Args: -S ExampleCountReads.scala -R exampleFASTA.fasta -I exampleBAM.bam 
INFO  00:30:53,285 HelpFormatter - Date/Time: 2012/08/09 00:30:53 
INFO  00:30:53,285 HelpFormatter - ---------------------------------------------------------------------- 
INFO  00:30:53,285 HelpFormatter - ---------------------------------------------------------------------- 
INFO  00:30:53,290 QCommandLine - Scripting ExampleCountReads 
INFO  00:30:53,364 QCommandLine - Added 1 functions 
INFO  00:30:53,364 QGraph - Generating graph. 
INFO  00:30:53,388 QGraph - ------- 
INFO  00:30:53,402 QGraph - Pending:  'java'  '-Xmx1024m'  '-Djava.io.tmpdir=/Users/vdauwera/sandbox/Q2/resources/tmp'  '-cp' '/Users/vdauwera/sandbox/Q2/Queue.jar'  'org.broadinstitute.sting.gatk.CommandLineGATK'  '-T' 'CountReads'  '-I' '/Users/vdauwera/sandbox/Q2/resources/exampleBAM.bam'  '-R' '/Users/vdauwera/sandbox/Q2/resources/exampleFASTA.fasta'  
INFO  00:30:53,403 QGraph - Log:     /Users/vdauwera/sandbox/Q2/resources/ExampleCountReads-1.out 
INFO  00:30:53,403 QGraph - Dry run completed successfully! 
INFO  00:30:53,404 QGraph - Re-run with "-run" to execute the functions. 
INFO  00:30:53,409 QCommandLine - Script completed successfully with 1 total jobs 
INFO  00:30:53,410 QCommandLine - Writing JobLogging GATKReport to file /Users/vdauwera/sandbox/Q2/resources/ExampleCountReads.jobreport.txt 

If you don't see this, check your spelling (GATK commands are case-sensitive), check that the files are in your working directory, and if necessary, re-check that the GATK and Queue are properly installed.

If you do see this output, congratulations! You just successfully ran you first Queue dry run!

2. Run the analysis for real

Once you have verified that the Queue functions have been generated successfully, you can execute the pipeline by appending -run to the command line.

Action

Instead of this command, which we used earlier:

java -Djava.io.tmpdir=tmp -jar Queue.jar -S ExampleCountReads.scala -R exampleFASTA.fasta -I exampleBAM.bam

this time you type this:

java -Djava.io.tmpdir=tmp -jar Queue.jar -S ExampleCountReads.scala -R exampleFASTA.fasta -I exampleBAM.bam -run

See the difference?

Result

You should see output that looks nearly identical to this:

INFO  00:56:33,688 QScriptManager - Compiling 1 QScript 
INFO  00:56:39,327 QScriptManager - Compilation complete 
INFO  00:56:39,487 HelpFormatter - ---------------------------------------------------------------------- 
INFO  00:56:39,487 HelpFormatter - Queue v2.0-36-gf5c1c1a, Compiled 2012/08/08 20:18:21 
INFO  00:56:39,488 HelpFormatter - Copyright (c) 2012 The Broad Institute 
INFO  00:56:39,488 HelpFormatter - Fro support and documentation go to http://www.broadinstitute.org/gatk 
INFO  00:56:39,489 HelpFormatter - Program Args: -S ExampleCountReads.scala -R exampleFASTA.fasta -I exampleBAM.bam -run 
INFO  00:56:39,490 HelpFormatter - Date/Time: 2012/08/09 00:56:39 
INFO  00:56:39,490 HelpFormatter - ---------------------------------------------------------------------- 
INFO  00:56:39,491 HelpFormatter - ---------------------------------------------------------------------- 
INFO  00:56:39,498 QCommandLine - Scripting ExampleCountReads 
INFO  00:56:39,569 QCommandLine - Added 1 functions 
INFO  00:56:39,569 QGraph - Generating graph. 
INFO  00:56:39,589 QGraph - Running jobs. 
INFO  00:56:39,623 FunctionEdge - Starting:  'java'  '-Xmx1024m'  '-Djava.io.tmpdir=/Users/vdauwera/sandbox/Q2/resources/tmp'  '-cp' '/Users/vdauwera/sandbox/Q2/Queue.jar'  'org.broadinstitute.sting.gatk.CommandLineGATK'  '-T' 'CountReads'  '-I' '/Users/vdauwera/sandbox/Q2/resources/exampleBAM.bam'  '-R' '/Users/vdauwera/sandbox/Q2/resources/exampleFASTA.fasta'  
INFO  00:56:39,623 FunctionEdge - Output written to /Users/GG/codespace/GATK/Q2/resources/ExampleCountReads-1.out 
INFO  00:56:50,301 QGraph - 0 Pend, 1 Run, 0 Fail, 0 Done 
INFO  00:57:09,827 FunctionEdge - Done:  'java'  '-Xmx1024m'  '-Djava.io.tmpdir=/Users/vdauwera/sandbox/Q2/resources/tmp'  '-cp' '/Users/vdauwera/sandbox/Q2/resources/Queue.jar'  'org.broadinstitute.sting.gatk.CommandLineGATK'  '-T' 'CountReads'  '-I' '/Users/vdauwera/sandbox/Q2/resources/exampleBAM.bam'  '-R' '/Users/vdauwera/sandbox/Q2/resources/exampleFASTA.fasta'  
INFO  00:57:09,828 QGraph - 0 Pend, 0 Run, 0 Fail, 1 Done 
INFO  00:57:09,835 QCommandLine - Script completed successfully with 1 total jobs 
INFO  00:57:09,835 QCommandLine - Writing JobLogging GATKReport to file /Users/vdauwera/sandbox/Q2/resources/ExampleCountReads.jobreport.txt 
INFO  00:57:10,107 QCommandLine - Plotting JobLogging GATKReport to file /Users/vdauwera/sandbox/Q2/resources/ExampleCountReads.jobreport.pdf 
WARN  00:57:18,597 RScriptExecutor - RScript exited with 1. Run with -l DEBUG for more info. 

Great! It works!

The results of the traversal will be written to a file in the current directory. The name of the file will be printed in the output, ExampleCountReads.out in this example.

If for some reason the run was interrupted, in most cases you can resume by just launching the command. Queue will pick up where it left off without redoing the parts that ran successfully.

3. Running on a computing farm

Run with -bsub to run on LSF, or for early Grid Engine support see Queue with Grid Engine.

See also QFunction and Command Line Options for more info on Queue options.

Objective

Run a basic analysis command on example data.

Prerequisites

Steps

  1. Invoke the GATK CountReads command
  2. Further exercises

1. Invoke the GATK CountReads command

A very simple analysis that you can do with the GATK is getting a count of the reads in a BAM file. The GATK is capable of much more powerful analyses, but this is a good starting example because there are very few things that can go wrong.

So we are going to count the reads in the file exampleBAM.bam, which you can find in the GATK resource bundle along with its associated index (same file name with .bai extension), as well as the example reference exampleFASTA.fasta and its associated index (same file name with .fai extension) and dictionary (same file name with .dict extension). Copy them to your working directory so that your directory contents look like this:

[bm4dd-56b:~/codespace/gatk/sandbox] vdauwera% ls -la
drwxr-xr-x  9 vdauwera  CHARLES\Domain Users     306 Jul 25 16:29 .
drwxr-xr-x@ 6 vdauwera  CHARLES\Domain Users     204 Jul 25 15:31 ..
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users    3635 Apr 10 07:39 exampleBAM.bam
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users     232 Apr 10 07:39 exampleBAM.bam.bai
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users     148 Apr 10 07:39 exampleFASTA.dict
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users  101673 Apr 10 07:39 exampleFASTA.fasta
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users      20 Apr 10 07:39 exampleFASTA.fasta.fai

Action

Type the following command:

java -jar <path to GenomeAnalysisTK.jar> -T CountReads -R exampleFASTA.fasta -I exampleBAM.bam 

where -T CountReads specifies which analysis tool we want to use, -R exampleFASTA.fasta specifies the reference sequence, and -I exampleBAM.bam specifies the file of aligned reads we want to analyze.

For any analysis that you want to run on a set of aligned reads, you will always need to use at least these three arguments:

  • -T for the tool name, which specifices the corresponding analysis
  • -R for the reference sequence file
  • -I for the input BAM file of aligned reads

They don't have to be in that order in your command, but this way you can remember that you need them if you TRI...

Expected Result

After a few seconds you should see output that looks like to this:

INFO  16:17:45,945 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:17:45,946 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.0-22-g40f97eb, Compiled 2012/07/25 15:29:41 
INFO  16:17:45,947 HelpFormatter - Copyright (c) 2010 The Broad Institute 
INFO  16:17:45,947 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk 
INFO  16:17:45,947 HelpFormatter - Program Args: -T CountReads -R exampleFASTA.fasta -I exampleBAM.bam 
INFO  16:17:45,947 HelpFormatter - Date/Time: 2012/07/25 16:17:45 
INFO  16:17:45,947 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:17:45,948 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:17:45,950 GenomeAnalysisEngine - Strictness is SILENT 
INFO  16:17:45,982 SAMDataSource$SAMReaders - Initializing SAMRecords in serial 
INFO  16:17:45,993 SAMDataSource$SAMReaders - Done initializing BAM readers: total time 0.01 
INFO  16:17:46,060 TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
INFO  16:17:46,060 TraversalEngine -        Location processed.reads  runtime per.1M.reads completed total.runtime remaining 
INFO  16:17:46,061 Walker - [REDUCE RESULT] Traversal result is: 33 
INFO  16:17:46,061 TraversalEngine - Total runtime 0.00 secs, 0.00 min, 0.00 hours 
INFO  16:17:46,100 TraversalEngine - 0 reads were filtered out during traversal out of 33 total (0.00%) 
INFO  16:17:46,729 GATKRunReport - Uploaded run statistics report to AWS S3 

Depending on the GATK release, you may see slightly different information output, but you know everything is running correctly if you see the line:

INFO  21:53:04,556 Walker - [REDUCE RESULT] Traversal result is: 33 

somewhere in your output.

If you don't see this, check your spelling (GATK commands are case-sensitive), check that the files are in your working directory, and if necessary, re-check that the GATK is properly installed.

If you do see this output, congratulations! You just successfully ran you first GATK analysis!

Basically the output you see means that the CountReadsWalker (which you invoked with the command line option -T CountReads) counted 33 reads in the exampleBAM.bam file, which is exactly what we expect to see.

Wait, what is this walker thing?

In the GATK jargon, we call the tools walkers because the way they work is that they walk through the dataset --either along the reference sequence (LocusWalkers), or down the list of reads in the BAM file (ReadWalkers)-- collecting the requested information along the way.

2. Further Exercises

Now that you're rocking the read counts, you can start to expand your use of the GATK command line.

Let's say you don't care about counting reads anymore; now you want to know the number of loci (positions on the genome) that are covered by one or more reads. The name of the tool, or walker, that does this is CountLoci. Since the structure of the GATK command is basically always the same, you can simply switch the tool name, right?

Action

Instead of this command, which we used earlier:

java -jar <path to GenomeAnalysisTK.jar> -T CountReads -R exampleFASTA.fasta -I exampleBAM.bam 

this time you type this:

java -jar <path to GenomeAnalysisTK.jar> -T CountLoci -R exampleFASTA.fasta -I exampleBAM.bam 

See the difference?

Result

You should see something like this output:

INFO  16:18:26,183 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:18:26,185 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.0-22-g40f97eb, Compiled 2012/07/25 15:29:41 
INFO  16:18:26,185 HelpFormatter - Copyright (c) 2010 The Broad Institute 
INFO  16:18:26,185 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk 
INFO  16:18:26,186 HelpFormatter - Program Args: -T CountLoci -R exampleFASTA.fasta -I exampleBAM.bam 
INFO  16:18:26,186 HelpFormatter - Date/Time: 2012/07/25 16:18:26 
INFO  16:18:26,186 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:18:26,186 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:18:26,189 GenomeAnalysisEngine - Strictness is SILENT 
INFO  16:18:26,222 SAMDataSource$SAMReaders - Initializing SAMRecords in serial 
INFO  16:18:26,233 SAMDataSource$SAMReaders - Done initializing BAM readers: total time 0.01 
INFO  16:18:26,351 TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
INFO  16:18:26,351 TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining 
2052
INFO  16:18:26,411 TraversalEngine - Total runtime 0.08 secs, 0.00 min, 0.00 hours 
INFO  16:18:26,450 TraversalEngine - 0 reads were filtered out during traversal out of 33 total (0.00%) 
INFO  16:18:27,124 GATKRunReport - Uploaded run statistics report to AWS S3 

Great! But wait -- where's the result? Last time the result was given on this line:

INFO  21:53:04,556 Walker - [REDUCE RESULT] Traversal result is: 33 

But this time there is no line that says [REDUCE RESULT]! Is something wrong?

Not really. The program ran just fine -- but we forgot to give it an output file name. You see, the CountLoci walker is set up to output the result of its calculations to a text file, unlike CountReads, which is perfectly happy to output its result to the terminal screen.

Action

So we repeat the command, but this time we specify an output file, like this:

java -jar <path to GenomeAnalysisTK.jar> -T CountLoci -R exampleFASTA.fasta -I exampleBAM.bam -o output.txt

where -o (lowercase o, not zero) is used to specify the output.

Result

You should get essentially the same output on the terminal screen as previously (but notice the difference in the line that contains Program Args -- the new argument is included):

INFO  16:29:15,451 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:29:15,453 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.0-22-g40f97eb, Compiled 2012/07/25 15:29:41 
INFO  16:29:15,453 HelpFormatter - Copyright (c) 2010 The Broad Institute 
INFO  16:29:15,453 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk 
INFO  16:29:15,453 HelpFormatter - Program Args: -T CountLoci -R exampleFASTA.fasta -I exampleBAM.bam -o output.txt 
INFO  16:29:15,454 HelpFormatter - Date/Time: 2012/07/25 16:29:15 
INFO  16:29:15,454 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:29:15,454 HelpFormatter - --------------------------------------------------------------------------------- 
INFO  16:29:15,457 GenomeAnalysisEngine - Strictness is SILENT 
INFO  16:29:15,488 SAMDataSource$SAMReaders - Initializing SAMRecords in serial 
INFO  16:29:15,499 SAMDataSource$SAMReaders - Done initializing BAM readers: total time 0.01 
INFO  16:29:15,618 TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
INFO  16:29:15,618 TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining 
INFO  16:29:15,679 TraversalEngine - Total runtime 0.08 secs, 0.00 min, 0.00 hours 
INFO  16:29:15,718 TraversalEngine - 0 reads were filtered out during traversal out of 33 total (0.00%) 
INFO  16:29:16,712 GATKRunReport - Uploaded run statistics report to AWS S3 

This time however, if we look inside the working directory, there is a newly created file there called output.txt.

[bm4dd-56b:~/codespace/gatk/sandbox] vdauwera% ls -la
drwxr-xr-x  9 vdauwera  CHARLES\Domain Users     306 Jul 25 16:29 .
drwxr-xr-x@ 6 vdauwera  CHARLES\Domain Users     204 Jul 25 15:31 ..
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users    3635 Apr 10 07:39 exampleBAM.bam
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users     232 Apr 10 07:39 exampleBAM.bam.bai
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users     148 Apr 10 07:39 exampleFASTA.dict
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users  101673 Apr 10 07:39 exampleFASTA.fasta
-rw-r--r--@ 1 vdauwera  CHARLES\Domain Users      20 Apr 10 07:39 exampleFASTA.fasta.fai
-rw-r--r--  1 vdauwera  CHARLES\Domain Users       5 Jul 25 16:29 output.txt

This file contains the result of the analysis:

[bm4dd-56b:~/codespace/gatk/sandbox] vdauwera% cat output.txt 
2052

This means that there are 2052 loci in the reference sequence that are covered by at least one or more reads in the BAM file.

Discussion

Okay then, but why not show the full, correct command in the first place? Because this was a good opportunity for you to learn a few of the caveats of the GATK command system, which may save you a lot of frustration later on.

Beyond the common basic arguments that almost all GATK walkers require, most of them also have specific requirements or options that are important to how they work. You should always check what are the specific arguments that are required, recommended and/or optional for the walker you want to use before starting an analysis.

Fortunately the GATK is set up to complain (i.e. terminate with an error message) if you try to run it without specifying a required argument. For example, if you try to run this:

java -jar <path to GenomeAnalysisTK.jar> -T CountLoci -R exampleFASTA.fasta

the GATK will spit out a wall of text, including the basic usage guide that you can invoke with the --help option, and more importantly, the following error message:

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A USER ERROR has occurred (version 2.0-22-g40f97eb): 
##### ERROR The invalid arguments or inputs must be corrected before the GATK can proceed
##### ERROR Please do not post this error to the GATK forum
##### ERROR
##### ERROR See the documentation (rerun with -h) for this tool to view allowable command-line arguments.
##### ERROR Visit our website and forum for extensive documentation and answers to 
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: Walker requires reads but none were provided.
##### ERROR ------------------------------------------------------------------------------------------

You see the line that says ERROR MESSAGE: Walker requires reads but none were provided? This tells you exactly what was wrong with your command.

So the GATK will not run if a walker does not have all the required inputs. That's a good thing! But in the case of our first attempt at running CountLoci, the -o argument is not required by the GATK to run -- it's just highly desirable if you actually want the result of the analysis!

There will be many other cases of walkers with arguments that are not strictly required, but highly desirable if you want the results to be meaningful.

So, at the risk of getting repetitive, always read the documentation of each walker that you want to use!

Objective

Test that the GATK is correctly installed, and that the supporting tools like Java are in your path.

Prerequisites

  • Basic familiarity with the command-line environment
  • Understand what is a PATH variable
  • GATK downloaded and placed on path

Steps

  1. Invoke the GATK usage/help message
  2. Troubleshooting

1. Invoke the GATK usage/help message

The command we're going to run is a very simple command that asks the GATK to print out a list of available command-line arguments and options. It is so simple that it will ALWAYS work if your GATK package is installed correctly.

Note that this command is also helpful when you're trying to remember something like the right spelling or short name for an argument and for whatever reason you don't have access to the web-based documentation.

Action

Type the following command:

java -jar <path to GenomeAnalysisTK.jar> --help

replacing the <path to GenomeAnalysisTK.jar> bit with the path you have set up in your command-line environment.

Expected Result

You should see usage output similar to the following:

usage: java -jar GenomeAnalysisTK.jar -T <analysis_type> [-I <input_file>] [-L 
        <intervals>] [-R <reference_sequence>] [-B <rodBind>] [-D <DBSNP>] [-H 
        <hapmap>] [-hc <hapmap_chip>] [-o <out>] [-e <err>] [-oe <outerr>] [-A] [-M 
        <maximum_reads>] [-sort <sort_on_the_fly>] [-compress <bam_compression>] [-fmq0] [-dfrac 
        <downsample_to_fraction>] [-dcov <downsample_to_coverage>] [-S 
        <validation_strictness>] [-U] [-P] [-dt] [-tblw] [-nt <numthreads>] [-l 
        <logging_level>] [-log <log_to_file>] [-quiet] [-debug] [-h]
-T,--analysis_type <analysis_type>                     Type of analysis to run
-I,--input_file <input_file>                           SAM or BAM file(s)
-L,--intervals <intervals>                             A list of genomic intervals over which 
                                                       to operate. Can be explicitly specified 
                                                       on the command line or in a file.
-R,--reference_sequence <reference_sequence>           Reference sequence file
-B,--rodBind <rodBind>                                 Bindings for reference-ordered data, in 
                                                       the form <name>,<type>,<file>
-D,--DBSNP <DBSNP>                                     DBSNP file
-H,--hapmap <hapmap>                                   Hapmap file
-hc,--hapmap_chip <hapmap_chip>                        Hapmap chip file
-o,--out <out>                                         An output file presented to the walker. 
                                                       Will overwrite contents if file exists.
-e,--err <err>                                         An error output file presented to the 
                                                       walker. Will overwrite contents if file 
                                                       exists.
-oe,--outerr <outerr>                                  A joint file for 'normal' and error 
                                                       output presented to the walker. Will 
                                                       overwrite contents if file exists.

...

If you see this message, your GATK installation is ok. You're good to go! If you don't see this message, and instead get an error message, proceed to the next section on troubleshooting.

2. Troubleshooting

Let's try to figure out what's not working.

Action

First, make sure that your Java version is at least 1.6, by typing the following command:

java -version

Expected Result

You should see something similar to the following text:

java version "1.6.0_12"
Java(TM) SE Runtime Environment (build 1.6.0_12-b04)
Java HotSpot(TM) 64-Bit Server VM (build 11.2-b01, mixed mode)  

Remedial actions

If the version is less then 1.6, install the newest version of Java onto the system. If you instead see something like

java: Command not found  

make sure that java is installed on your machine, and that your PATH variable contains the path to the java executables.

On a Mac running OS X 10.5+, you may need to run /Applications/Utilities/Java Preferences.app and drag Java SE 6 to the top to make your machine run version 1.6, even if it has been installed.

Objective

Test that Queue is correctly installed, and that the supporting tools like Java are in your path.

Prerequisites

  • Basic familiarity with the command-line environment
  • Understand what is a PATH variable
  • GATK installed
  • Queue downloaded and placed on path

Steps

  1. Invoke the Queue usage/help message
  2. Troubleshooting

1. Invoke the Queue usage/help message

The command we're going to run is a very simple command that asks Queue to print out a list of available command-line arguments and options. It is so simple that it will ALWAYS work if your Queue package is installed correctly.

Note that this command is also helpful when you're trying to remember something like the right spelling or short name for an argument and for whatever reason you don't have access to the web-based documentation.

Action

Type the following command:

java -jar <path to Queue.jar> --help

replacing the <path to Queue.jar> bit with the path you have set up in your command-line environment.

Expected Result

You should see usage output similar to the following:

usage: java -jar Queue.jar -S <script> [-jobPrefix <job_name_prefix>] [-jobQueue <job_queue>] [-jobProject <job_project>]
       [-jobSGDir <job_scatter_gather_directory>] [-memLimit <default_memory_limit>] [-runDir <run_directory>] [-tempDir
       <temp_directory>] [-emailHost <emailSmtpHost>] [-emailPort <emailSmtpPort>] [-emailTLS] [-emailSSL] [-emailUser
       <emailUsername>] [-emailPass <emailPassword>] [-emailPassFile <emailPasswordFile>] [-bsub] [-run] [-dot <dot_graph>]
       [-expandedDot <expanded_dot_graph>] [-startFromScratch] [-status] [-statusFrom <status_email_from>] [-statusTo
       <status_email_to>] [-keepIntermediates] [-retry <retry_failed>] [-l <logging_level>] [-log <log_to_file>] [-quiet]
       [-debug] [-h]

 -S,--script <script>                                                      QScript scala file
 -jobPrefix,--job_name_prefix <job_name_prefix>                            Default name prefix for compute farm jobs.
 -jobQueue,--job_queue <job_queue>                                         Default queue for compute farm jobs.
 -jobProject,--job_project <job_project>                                   Default project for compute farm jobs.
 -jobSGDir,--job_scatter_gather_directory <job_scatter_gather_directory>   Default directory to place scatter gather
                                                                           output for compute farm jobs.
 -memLimit,--default_memory_limit <default_memory_limit>                   Default memory limit for jobs, in gigabytes.
 -runDir,--run_directory <run_directory>                                   Root directory to run functions from.
 -tempDir,--temp_directory <temp_directory>                                Temp directory to pass to functions.
 -emailHost,--emailSmtpHost <emailSmtpHost>                                Email SMTP host. Defaults to localhost.
 -emailPort,--emailSmtpPort <emailSmtpPort>                                Email SMTP port. Defaults to 465 for ssl,
                                                                           otherwise 25.
 -emailTLS,--emailUseTLS                                                   Email should use TLS. Defaults to false.
 -emailSSL,--emailUseSSL                                                   Email should use SSL. Defaults to false.
 -emailUser,--emailUsername <emailUsername>                                Email SMTP username. Defaults to none.
 -emailPass,--emailPassword <emailPassword>                                Email SMTP password. Defaults to none. Not
                                                                           secure! See emailPassFile.
 -emailPassFile,--emailPasswordFile <emailPasswordFile>                    Email SMTP password file. Defaults to none.
 -bsub,--bsub_all_jobs                                                     Use bsub to submit jobs
 -run,--run_scripts                                                        Run QScripts.  Without this flag set only
                                                                           performs a dry run.
 -dot,--dot_graph <dot_graph>                                              Outputs the queue graph to a .dot file.  See:
                                                                           http://en.wikipedia.org/wiki/DOT_language
 -expandedDot,--expanded_dot_graph <expanded_dot_graph>                    Outputs the queue graph of scatter gather to
                                                                           a .dot file.  Otherwise overwrites the
                                                                           dot_graph
 -startFromScratch,--start_from_scratch                                    Runs all command line functions even if the
                                                                           outputs were previously output successfully.
 -status,--status                                                          Get status of jobs for the qscript
 -statusFrom,--status_email_from <status_email_from>                       Email address to send emails from upon
                                                                           completion or on error.
 -statusTo,--status_email_to <status_email_to>                             Email address to send emails to upon
                                                                           completion or on error.
 -keepIntermediates,--keep_intermediate_outputs                            After a successful run keep the outputs of
                                                                           any Function marked as intermediate.
 -retry,--retry_failed <retry_failed>                                      Retry the specified number of times after a
                                                                           command fails.  Defaults to no retries.
 -l,--logging_level <logging_level>                                        Set the minimum level of logging, i.e.
                                                                           setting INFO get's you INFO up to FATAL,
                                                                           setting ERROR gets you ERROR and FATAL level
                                                                           logging.
 -log,--log_to_file <log_to_file>                                          Set the logging location
 -quiet,--quiet_output_mode                                                Set the logging to quiet mode, no output to
                                                                           stdout
 -debug,--debug_mode                                                       Set the logging file string to include a lot
                                                                           of debugging information (SLOW!)
 -h,--help                                                                 Generate this help message

If you see this message, your Queue installation is ok. You're good to go! If you don't see this message, and instead get an error message, proceed to the next section on troubleshooting.

2. Troubleshooting

Let's try to figure out what's not working.

Action

First, make sure that your Java version is at least 1.6, by typing the following command:

java -version

Expected Result

You should see something similar to the following text:

java version "1.6.0_12"
Java(TM) SE Runtime Environment (build 1.6.0_12-b04)
Java HotSpot(TM) 64-Bit Server VM (build 11.2-b01, mixed mode)  

Remedial actions

If the version is less then 1.6, install the newest version of Java onto the system. If you instead see something like

java: Command not found  

make sure that java is installed on your machine, and that your PATH variable contains the path to the java executables.

On a Mac running OS X 10.5+, you may need to run /Applications/Utilities/Java Preferences.app and drag Java SE 6 to the top to make your machine run version 1.6, even if it has been installed.

1. Introduction

GATK-Queue is command-line scripting framework for defining multi-stage genomic analysis pipelines combined with an execution manager that runs those pipelines from end-to-end. Often processing genome data includes several steps to produces outputs, for example our BAM to VCF calling pipeline include among other things:

  • Local realignment around indels
  • Emitting raw SNP calls
  • Emitting indels
  • Masking the SNPs at indels
  • Annotating SNPs using chip data
  • Labeling suspicious calls based on filters
  • Creating a summary report with statistics

Running these tools one by one in series may often take weeks for processing, or would require custom scripting to try and optimize using parallel resources.

With a Queue script users can semantically define the multiple steps of the pipeline and then hand off the logistics of running the pipeline to completion. Queue runs independent jobs in parallel, handles transient errors, and uses various techniques such as running multiple copies of the same program on different portions of the genome to produce outputs faster.

2. Obtaining Queue

You have two options: donwload the binary distribution (prepackaged, ready to run program) or build it from source.

  • #### Download the binary

This is obviously the easiest way to go. Links are on the Downloads page.

  • #### Building Queue from source

Briefly, here's what you need to know/do:

Queue is part of the Sting repository. Download the source from our repository on Github. Run the following command:

git clone git://github.com/broadgsa/gatk.git Sting

Use ant to build the source.

cd Sting
ant queue

Queue uses the Ivy dependency manager to fetch all other dependencies. Just make sure you have suitable versions of the JDK and Ant!

See this article on how to test your installation of Queue.

3. Running Queue

See this article on running Queue for the first time for full details.

Queue arguments can be listed by running with --help

java -jar dist/Queue.jar --help

To list the arguments required by a QScript, add the script with -S and run with --help.

java -jar dist/Queue.jar -S script.scala --help

Note that by default queue runs in a "dry" mode, as explained in the link above. After verifying the generated commands execute the pipeline by adding -run.

See QFunction and Command Line Options for more info on adjusting Queue options.

4. QScripts

General Information

Queue pipelines are written as Scala 2.8 files with a bit of syntactic sugar, called QScripts.

Every QScript includes the following steps:

  • New instances of CommandLineFunctions are created
  • Input and output arguments are specified on each function
  • The function is added with add() to Queue for dispatch and monitoring

The basic command-line to run the Queue pipelines on the command line is

java -jar Queue.jar -S <script>.scala

See the main article Queue QScripts for more info on QScripts.

Supported QScripts

While most QScripts are analysis pipelines that are custom-built for specific projects, some have been released as supported tools. See

Example QScripts

The latest version of the example files are available in the Sting github repository under public/scala/qscript/examples

5. Visualization and Queue

QJobReport

Queue automatically generates GATKReport-formatted runtime information about executed jobs. See this presentation for a general introduction to QJobReport.

Note that Queue attempts to generate a standard visualization using an R script in the GATK public/R repository. You must provide a path to this location if you want the script to run automatically. Additionally the script requires the gsalib to be installed on the machine, which is typically done by providing its path in your .Rprofile file:

bm8da-dbe ~/Desktop/broadLocal/GATK/unstable % cat ~/.Rprofile .libPaths("/Users/depristo/Desktop/broadLocal/GATK/unstable/public/R/")

Caveats

  • The system only provides information about commands that have just run. Resuming from a partially completed job will only show the information for the jobs that just ran, and not for any of the completed commands. This is due to a structural limitation in Queue, and will be fixed when the Queue infrastructure improves

  • This feature only works for command line and LSF execution models. SGE should be easy to add for a motivated individual but we cannot test this capabilities here at the Broad. Please send us a patch if you do extend Queue to support SGE.

DOT visualization of Pipelines

Queue emits a queue.dot file to help visualize your commands. You can open this file in programs like DOT, OmniGraffle, etc to view your pipelines. By default the system will print out your LSF command lines, but this can be too much in a complex pipeline.

To clarify your pipeline, override the dotString() function:

class CountCovariates(bamIn: File, recalDataIn: File, args: String = "") extends GatkFunction {
    @Input(doc="foo") var bam = bamIn
    @Input(doc="foo") var bamIndex = bai(bamIn)
    @Output(doc="foo") var recalData = recalDataIn
    memoryLimit = Some(4)
    override def dotString = "CountCovariates: %s [args %s]".format(bamIn.getName, args)
    def commandLine = gatkCommandLine("CountCovariates") + args + " -l INFO -D /humgen/gsa-hpprojects/GATK/data/dbsnp_129_hg18.rod -I %s --max_reads_at_locus 20000 -cov ReadGroupCovariate -cov QualityScoreCovariate -cov CycleCovariate -cov DinucCovariate -recalFile %s".format(bam, recalData)
}

Here we only see CountCovariates my.bam [-OQ], for example, in the dot file. The base quality score recalibration pipeline, as visualized by DOT, can be viewed here:

6. Further reading

1. Operating system

The GATK runs natively on most if not all flavors of UNIX, which includes MacOSX, Linux and BSD. It is possible to get it running on Windows using Cygwin, but we don't provide any support nor instructions for that.

2. Java

The GATK is a Java-based program, so you'll need to have Java installed on your machine. The Java version should be at 1.6 (at this time we don't support 1.7). You can check what version you have by typing java -version at the command line. This article has some more details about what to do if you don't have the right version. Note that at this time we only support the Sun/Oracle Java JDK; OpenJDK is not supported.

3. Familiarity with command-line programs

The GATK does not have a Graphical User Interface (GUI). You don't open it by clicking on the .jar file; you have to use the Console (or Terminal) to input commands. If this is all new to you, we recommend you first learn about that and follow some online tutorials before trying to use the GATK. It's not difficult but you'll need to learn some jargon and get used to living without a mouse...

1. Reference Sequence

The GATK requires the reference sequence in a single reference sequence in FASTA format, with all contigs in the same file. The GATK requires strict adherence to the FASTA standard. Only the standard ACGT bases are accepted; no non-standard bases (W, for example) are tolerated. Gzipped fasta files will not work with the GATK, so please make sure to unzip them first. Please see this article for more information on preparing FASTA reference sequences for use with the GATK.

Human sequence

If you are using human data, your reads must be aligned to one of the official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The contig ordering in the reference you used must exactly match that of one of the official references canonical orderings. These are defined by historical karotyping of largest to smallest chromosomes, followed by the X, Y, and MT for the b3x references; the order is thus 1, 2, 3, ..., 10, 11, 12, ... 20, 21, 22, X, Y, MT. The hg1x references differ in that the chromosome names are prefixed with "chr" and chrM appears first instead of last. The GATK will detect misordered contigs (for example, lexicographically sorted) and throw an error. This draconian approach, though unnecessary technically, ensures that all supplementary data provided with the GATK works correctly. You can use ReorderSam to fix a BAM file aligned to a missorted reference sequence.

Our Best Practice recommendation is that you use a standard GATK reference from the GATK resource bundle.

2. Sequencing Reads

The only input format for NGS reads that the GATK supports is the [Sequence Alignment/Map (SAM)] format. See [SAM/BAM] for more details on the SAM/BAM format as well as Samtools and Picard, two complementary sets of utilities for working with SAM/BAM files.

In addition to being in SAM format, we require the following additional constraints in order to use your file with the GATK:

  • The file must be binary (with .bam file extension).
  • The file must be indexed.
  • The file must be sorted in coordinate order with respect to the reference (i.e. the contig ordering in your bam must exactly match that of the reference you are using).
  • The file must have a proper bam header with read groups. Each read group must contain the platform (PL) and sample (SM) tags. For the platform value, we currently support 454, LS454, Illumina, Solid, ABI_Solid, and CG (all case-insensitive).
  • Each read in the file must be associated with exactly one read group.

Below is an example well-formed SAM field header and fields from the 1000 Genomes Project:

@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:249250621    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1b22b98cdeb4a9304cb5d48026a85128
@SQ     SN:2    LN:243199373    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a0d9851da00400dec1098a9255ac712e
@SQ     SN:3    LN:198022430    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:fdfd811849cc2fadebc929bb925902e5
@SQ     SN:4    LN:191154276    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:23dccd106897542ad87d2765d28a19a1
@SQ     SN:5    LN:180915260    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:0740173db9ffd264d728f32784845cd7
@SQ     SN:6    LN:171115067    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1d3a93a248d92a729ee764823acbbc6b
@SQ     SN:7    LN:159138663    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:618366e953d6aaad97dbe4777c29375e
@SQ     SN:8    LN:146364022    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:96f514a9929e410c6651697bded59aec
@SQ     SN:9    LN:141213431    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:3e273117f15e0a400f01055d9f393768
@SQ     SN:10   LN:135534747    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:988c28e000e84c26d552359af1ea2e1d
@SQ     SN:11   LN:135006516    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:98c59049a2df285c76ffb1c6db8f8b96
@SQ     SN:12   LN:133851895    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:51851ac0e1a115847ad36449b0015864
@SQ     SN:13   LN:115169878    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:283f8d7892baa81b510a015719ca7b0b
@SQ     SN:14   LN:107349540    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:98f3cae32b2a2e9524bc19813927542e
@SQ     SN:15   LN:102531392    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:e5645a794a8238215b2cd77acb95a078
@SQ     SN:16   LN:90354753     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:fc9b1a7b42b97a864f56b348b06095e6
@SQ     SN:17   LN:81195210     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:351f64d4f4f9ddd45b35336ad97aa6de
@SQ     SN:18   LN:78077248     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c
@SQ     SN:19   LN:59128983     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1aacd71f30db8e561810913e0b72636d
@SQ     SN:20   LN:63025520     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:0dec9660ec1efaaf33281c0d5ea2560f
@SQ     SN:21   LN:48129895     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:2979a6085bfe28e3ad6f552f361ed74d
@SQ     SN:22   LN:51304566     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a718acaa6135fdca8357d5bfe94211dd
@SQ     SN:X    LN:155270560    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:7e0e2e580297b7764e31dbc80c2540dd
@SQ     SN:Y    LN:59373566     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1fa3474750af0948bdf97d5a0ee52e51
@SQ     SN:MT   LN:16569        AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:c68f52674c9fb33aef52dcf399755519
@RG     ID:ERR000162    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR000252    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001684    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001685    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001686    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001687    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001688    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001689    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001690    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002307    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002308    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002309    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002310    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002311    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002312    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002313    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002434    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@PG     ID:GATK TableRecalibration      VN:v2.2.16      CL:Covariates=[ReadGroupCovariate, QualityScoreCovariate, DinucCovariate, CycleCovariate], use_original_quals=true, defau 
t_read_group=DefaultReadGroup, default_platform=Illumina, force_read_group=null, force_platform=null, solid_recal_mode=SET_Q_ZERO, window_size_nqs=5, homopolymer_nback=7, except on_if_no_tile=false, pQ=5, maxQ=40, smoothing=137       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b4eb71ee878d3706246b7c1dbef69299
@PG     ID:bwa  VN:0.5.5
ERR001685.4315085       16      1       9997    25      35M     *       0       0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     ?8:C7ACAABBCBAAB?CCAABBEBA@ACEBBB@?     XT:A:U  XN:i:4    X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001685  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:>>:>2>>>>>>>>>>>>>>>>>>?>>>>??>???>
ERR001689.1165834       117     1       9997    0       *       =       9997    0       CCGATCTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     >7AA<@@C?@?B?B??>9?B??>A?B???BAB??@     RG:Z:ERR001689    OQ:Z:>:<<8<<<><<><><<>7<>>>?>>??>???????
ERR001689.1165834       185     1       9997    25      35M     =       9997    0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     758A:?>>8?=@@>>?;4<>=??@@==??@?==?8     XT:A:U  XN:i:4    SM:i:25 AM:i:0  X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001689  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:;74>7><><><>>>>><:<>>>>>>>>>>>>>>>>
ERR001688.2681347       117     1       9998    0       *       =       9998    0       CGATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     5@BA@A6B???A?B??>B@B??>B@B??>BAB???     RG:Z:ERR001688    OQ:Z:=>>>><4><<?><??????????????????????       

Fixing BAM files with alternative sortings

The GATK requires that the BAM file be sorted in the same order as the reference. Unfortunately, many BAM files have headers that are sorted in some other order -- lexicographical order is a common alternative. To resort the BAM file please use ReorderSam.

3. Intervals

The GATK accept interval files for processing subsets of the genome in Picard-style interval lists. These files have a .interval_list extension and look like this:

@HD     VN:1.0  SO:coordinate
@SQ     SN:1    LN:249250621    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1b22b98cdeb4a9304cb5d48026a85128     SP:Homo Sapiens
@SQ     SN:2    LN:243199373    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a0d9851da00400dec1098a9255ac712e     SP:Homo Sapiens
@SQ     SN:3    LN:198022430    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:fdfd811849cc2fadebc929bb925902e5     SP:Homo Sapiens
@SQ     SN:4    LN:191154276    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:23dccd106897542ad87d2765d28a19a1     SP:Homo Sapiens
@SQ     SN:5    LN:180915260    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:0740173db9ffd264d728f32784845cd7     SP:Homo Sapiens
@SQ     SN:6    LN:171115067    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1d3a93a248d92a729ee764823acbbc6b     SP:Homo Sapiens
@SQ     SN:7    LN:159138663    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:618366e953d6aaad97dbe4777c29375e     SP:Homo Sapiens
@SQ     SN:8    LN:146364022    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:96f514a9929e410c6651697bded59aec     SP:Homo Sapiens
@SQ     SN:9    LN:141213431    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:3e273117f15e0a400f01055d9f393768     SP:Homo Sapiens
@SQ     SN:10   LN:135534747    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:988c28e000e84c26d552359af1ea2e1d     SP:Homo Sapiens
@SQ     SN:11   LN:135006516    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:98c59049a2df285c76ffb1c6db8f8b96     SP:Homo Sapiens
@SQ     SN:12   LN:133851895    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:51851ac0e1a115847ad36449b0015864     SP:Homo Sapiens
@SQ     SN:13   LN:115169878    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:283f8d7892baa81b510a015719ca7b0b     SP:Homo Sapiens
@SQ     SN:14   LN:107349540    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:98f3cae32b2a2e9524bc19813927542e     SP:Homo Sapiens
@SQ     SN:15   LN:102531392    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:e5645a794a8238215b2cd77acb95a078     SP:Homo Sapiens
@SQ     SN:16   LN:90354753     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:fc9b1a7b42b97a864f56b348b06095e6     SP:Homo Sapiens
@SQ     SN:17   LN:81195210     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:351f64d4f4f9ddd45b35336ad97aa6de     SP:Homo Sapiens
@SQ     SN:18   LN:78077248     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c     SP:Homo Sapiens
@SQ     SN:19   LN:59128983     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1aacd71f30db8e561810913e0b72636d     SP:Homo Sapiens
@SQ     SN:20   LN:63025520     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:0dec9660ec1efaaf33281c0d5ea2560f     SP:Homo Sapiens
@SQ     SN:21   LN:48129895     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:2979a6085bfe28e3ad6f552f361ed74d     SP:Homo Sapiens
@SQ     SN:22   LN:51304566     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a718acaa6135fdca8357d5bfe94211dd     SP:Homo Sapiens
@SQ     SN:X    LN:155270560    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:7e0e2e580297b7764e31dbc80c2540dd     SP:Homo Sapiens
@SQ     SN:Y    LN:59373566     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1fa3474750af0948bdf97d5a0ee52e51     SP:Homo Sapiens
@SQ     SN:MT   LN:16569        AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:c68f52674c9fb33aef52dcf399755519     SP:Homo Sapiens
1       30366   30503   +       target_1
1       69089   70010   +       target_2
1       367657  368599  +       target_3
1       621094  622036  +       target_4
1       861320  861395  +       target_5
1       865533  865718  +       target_6
...

consisting of a SAM-file-like sequence dictionary (the header), and targets in the form of + . These interval lists are tab-delimited. They are also 1-based (first position in the genome is position 1, not position 0). The easiest way to create such a file is to combine your reference file's sequence dictionary (the file stored alongside the reference fasta file with the .dict extension) and your intervals into one file.

You can also specify a list of intervals in a .interval_list file formatted as :- (one interval per line). No sequence dictionary is necessary. This file uses 1-based coordinates.

Finally, we also accept BED style interval lists. Warning: this file format is 0-based for the start coordinates, so coordinates taken from 1-based formats should be offset by 1.

4. Reference Ordered Data (ROD) file formats

The GATK can associate arbitrary reference ordered data (ROD) files with named tracks for all tools. Some tools require specific ROD data files for processing, and developers are free to write tools that access arbitrary data sets using the ROD interface. The general ROD system has the following syntax:

-argumentName:name,type file

Where name is the name in the GATK tool (like "eval" in VariantEval), type is the type of the file, such as VCF or dbSNP, and file is the path to the file containing the ROD data.

The GATK supports several common file formats for reading ROD data:

  • VCF : VCF type, the recommended format for representing variant loci and genotype calls. The GATK will only process valid VCF files; VCFTools provides the official VCF validator. See [here] for a useful poster detailing the VCF specification.
  • UCSC formated dbSNP : dbSNP type, UCSC dbSNP database output
  • BED : BED type, a general purpose format for representing genomic interval data, useful for masks and other interval outputs. Please note that the bed format is 0-based while most other formats are 1-based.

Note that we no longer support the PED format. See here for converting .ped files to VCF.

1. What it is and how it helps us improve the GATK

Since September, 2010, the GATK has had a "phone-home" feature that sends us information about each GATK run via the Broad filesystem (within the Broad) and Amazon's S3 cloud storage service (outside the Broad). This feature is enabled by default.

The information provided by the phone-home feature is critical in driving improvements to the GATK

  • By recording detailed information about each error that occurs, it enables GATK developers to identify and fix previously-unknown bugs in the GATK. We are constantly monitoring the errors our users encounter and do our best to fix those errors that are caused by bugs in our code.
  • It allows us to better understand how the GATK is used in practice and adjust our documentation and development goals for common use cases.
  • It gives us a picture of which versions of the GATK are in use over time, and how successful we've been at encouraging users to migrate from obsolete or broken versions of the GATK to newer, improved versions.
  • It tells us which tools are most commonly used, allowing us to monitor the adoption of newly-released tools and abandonment of outdated tools.
  • It provides us with a sense of the overall size of our user base and the major organizations/institutions using the GATK.

2. What information is sent to us

Below are two example GATK Run Reports showing exactly what information is sent to us each time the GATK phones home.

A successful run:

<GATK-run-report>
    <id>D7D31ULwTSxlAwnEOSmW6Z4PawXwMxEz</id>
    <start-time>2012/03/10 20.21.19</start-time>
    <end-time>2012/03/10 20.21.19</end-time>
    <run-time>0</run-time>
    <walker-name>CountReads</walker-name>
    <svn-version>1.4-483-g63ecdb2</svn-version>
    <total-memory>85000192</total-memory>
    <max-memory>129957888</max-memory>
    <user-name>depristo</user-name>
    <host-name>10.0.1.10</host-name>
    <java>Apple Inc.-1.6.0_26</java>
    <machine>Mac OS X-x86_64</machine>
    <iterations>105</iterations>
</GATK-run-report>

A run where an exception has occurred:

<GATK-run-report>
   <id>yX3AnltsqIlXH9kAQqTWHQUd8CQ5bikz</id>   
   <exception>
      <message>Failed to parse Genome Location string: 20:10,000,000-10,000,001x</message>
      <stacktrace class="java.util.ArrayList"> 
         <string>org.broadinstitute.sting.utils.GenomeLocParser.parseGenomeLoc(GenomeLocParser.java:377)</string>
         <string>org.broadinstitute.sting.utils.interval.IntervalUtils.parseIntervalArguments(IntervalUtils.java:82)</string>
         <string>org.broadinstitute.sting.commandline.IntervalBinding.getIntervals(IntervalBinding.java:106)</string>
         <string>org.broadinstitute.sting.gatk.GenomeAnalysisEngine.loadIntervals(GenomeAnalysisEngine.java:618)</string>
         <string>org.broadinstitute.sting.gatk.GenomeAnalysisEngine.initializeIntervals(GenomeAnalysisEngine.java:585)</string>
         <string>org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:231)</string>
         <string>org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:128)</string>
         <string>org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:236)</string>
         <string>org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:146)</string>
         <string>org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:92)</string>
      </stacktrace>
      <cause>
         <message>Position: &apos;10,000,001x&apos; contains invalid chars.</message>
         <stacktrace class="java.util.ArrayList">
            <string>org.broadinstitute.sting.utils.GenomeLocParser.parsePosition(GenomeLocParser.java:411)</string>
            <string>org.broadinstitute.sting.utils.GenomeLocParser.parseGenomeLoc(GenomeLocParser.java:374)</string>
            <string>org.broadinstitute.sting.utils.interval.IntervalUtils.parseIntervalArguments(IntervalUtils.java:82)</string>
            <string>org.broadinstitute.sting.commandline.IntervalBinding.getIntervals(IntervalBinding.java:106)</string>
            <string>org.broadinstitute.sting.gatk.GenomeAnalysisEngine.loadIntervals(GenomeAnalysisEngine.java:618)</string>
            <string>org.broadinstitute.sting.gatk.GenomeAnalysisEngine.initializeIntervals(GenomeAnalysisEngine.java:585)</string>
            <string>org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:231)</string>
            <string>org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:128)</string>
            <string>org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:236)</string>
            <string>org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:146)</string>
            <string>org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:92)</string>
         </stacktrace>
         <is-user-exception>false</is-user-exception>
      </cause>
      <is-user-exception>true</is-user-exception>
   </exception>
   <start-time>2012/03/10 20.19.52</start-time>
   <end-time>2012/03/10 20.19.52</end-time>
   <run-time>0</run-time>
   <walker-name>CountReads</walker-name>
   <svn-version>1.4-483-g63ecdb2</svn-version>
   <total-memory>85000192</total-memory>
   <max-memory>129957888</max-memory>
   <user-name>depristo</user-name>
   <host-name>10.0.1.10</host-name>
   <java>Apple Inc.-1.6.0_26</java>
   <machine>Mac OS X-x86_64</machine>
   <iterations>0</iterations>
</GATK-run-report>

Note that as of GATK 1.5 we no longer collect information about the command-line executed, the working directory, or tmp directory.

3. Disabling Phone Home

The GATK is currently in the process of evolving to require interaction with Amazon S3 as a normal part of each run. For this reason, and because the information contained in the GATK run reports is so critical in driving improvements to the GATK, we strongly discourage our users from disabling the phone-home feature.

At the same time, we recognize that some of our users do have legitimate reasons for needing to run the GATK with phone-home disabled, and we don't wish to make it impossible for these users to run the GATK.

Examples of legitimate reasons for disabling Phone Home

  • Technical reasons: Your local network might have restrictions in place that don't allow the GATK to access external resources, or you might need to run the GATK in a network-less environment.

  • Organizational reasons: Your organization's policies might forbid the dissemination of one or more pieces of information contained in the GATK run report.

For such users we have provided an -et NO_ET option in the GATK to disable the phone-home feature. To use this option in GATK 1.5 and later, you need to contact us to request a key. Instructions for doing so are below.

How to obtain and use a GATK key

To obtain a GATK key, please fill out the request form.

Running the GATK with a key is simple: you just need to append a -K your.key argument to your customary command line, where your.key is the path to the key file you obtained from us:

java -jar dist/GenomeAnalysisTK.jar \
    -T PrintReads \
    -I public/testdata/exampleBAM.bam \
    -R public/testdata/exampleFASTA.fasta \
    -et NO_ET \
    -K your.key

The -K argument is only necessary when running the GATK with the NO_ET option.

Troubleshooting key-related problems

  • Corrupt/Unreadable/Revoked Keys

If you get an error message from the GATK saying that your key is corrupt, unreadable, or has been revoked, please email '''gsahelp@broadinstitute.org''' to ask for a replacement key.

  • GATK Public Key Not Found

If you get an error message stating that the GATK public key could not be located or read, then something is likely wrong with your build of the GATK. If you're running the binary release, try downloading it again. If you're compiling from source, try doing an ant clean and re-compiling. If all else fails, please ask for help on our community forum.

What does GSA use Phone Home data for?

We use the phone home data for three main purposes. First, we monitor the input logs for errors that occur in the GATK, and proactively fix them in the codebase. Second, we monitor the usage rates of the GATK in general and specific versions of the GATK to explain how widely used the GATK is to funding agencies and other potential supporters. Finally, we monitor adoption rates of specific GATK tools to understand how quickly new tools reach our users. Many of these analyses require us to aggregate the data by unique user, which is why we still collect the username of the individual who ran the GATK (as you can see in the plots). Examples of all three uses are shown in the Tableau graphs below, which update each night and are sent to the GATK members each morning for review.

You probably know by now that GATK-Lite is a free-for-everyone and completely open-source version of the GATK (licensed under the original MIT license).

But what's in the box? What can GATK-Lite do -- or rather, what can it not do that the full version (let's call it GATK-Full) can? And what does that mean exactly, in terms of functionality, reliability and power?

To really understand the differences between GATK-Lite and GATK-Full, you need some more information on how the GATK works, and how we work to develop and improve it.

First you need to understand what are the two core components of the GATK: the engine and tools (see picture below).

As explained here, the engine handles all the common work that's related to data access, conversion and traversal, as well as high-performance computing features. The engine is supported by an infrastructure of software libraries. If the GATK was a car, that would be the engine and chassis. What we call the **tools* are attached on top of that, and they provide the various analytical and processing functionalities like variant calling and base or variant recalibration. On your car, that would be headlights, airbags and so on.

Core GATK components

Second is how we work on developing the GATK, and what it means for how improvements are shared (or not) between Lite and Full.

We do all our development work on a single codebase. This means that everything --the engine and all tools-- is on one common workbench. There are not different versions that we work on in parallel -- that would be crazy to manage! That's why the version numbers of GATK-Lite and GATK-Full always match: if the latest GATK-Full version is numbered 2.1-13, then the latest GATK-Lite is also numbered 2.1-13.

The most important consequence of this setup is that when we make improvements to the infrastructure and engine, the same improvements will end up in GATK Lite and in GATK Full. So for the purposes of power, speed and robustness of the GATK that is determined by the engine, there is no difference between them.

For the tools, it's a little more complicated -- but not much. When we "build" the GATK binaries (the .jar files), we put everything from the workbench into the Full build, but we only put a subset into the Lite build. Note that this Lite subset is pretty big -- it contains all the tools that were previously available in GATK 1.x versions, and always will. We also reserve the right to add previews or not-fully-featured versions of the new tools that are in Full, at our discretion, to the Lite build.

So there are two basic types of differences between the tools available in the Lite and Full builds (see picture below).

  1. We have a new tool that performs a brand new function (which wasn't available in GATK 1.x), and we only include it in the Full build.

  2. We have a tool that has some new add-on capabilities (which weren't possible in GATK 1.x); we put the tool in both the Lite and the Full build, but the add-ons are only available in the Full build.

Tools in Lite vs. Full

Reprising the car analogy, GATK-Lite and GATK-Full are like two versions of the same car -- the basic version and the fully-equipped one. They both have the exact same engine, and most of the equipment (tools) is the same -- for example, they both have the same airbag system, and they both have headlights. But there are a few important differences:

  1. The GATK-Full car comes with a GPS (sat-nav for our UK friends), for which the Lite car has no equivalent. You could buy a portable GPS unit from a third-party store for your Lite car, but it might not be as good, and certainly not as convenient, as the Full car's built-in one.

  2. Both cars have windows of course, but the Full car has power windows, while the Lite car doesn't. The Lite windows can open and close, but you have to operate them by hand, which is much slower.

So, to summarize:

The underlying engine is exactly the same in both GATK-Lite and GATK-Full. Most functionalities are available in both builds, performed by the same tools. Some functionalities are available in both builds, but they are performed by different tools, and the tool in the Full build is better. New, cutting-edge functionalities are only available in the Full build, and there is no equivalent in the Lite build.

We hope this clears up some of the confusion surrounding GATK-Lite. If not, please leave a comment and we'll do our best to clarify further!

Overview

One of the key challenges of working with next-gen sequence data is that input files are usually very large. We can’t just make the program open the files, load all the data into memory and perform whatever analysis is needed on all of it in one go. It’s just too much work, even for supercomputers.

Instead, we make the program cut the job into smaller tasks that the computer can easily process separately. Then we have it combine the results of each step into the final result.

Map/Reduce

Map/Reduce is the technique we use to achieve this. It consists of three steps formally called filter, map and reduce. Let’s apply it to an example case where we want to find out what is the average depth of coverage in our dataset for a certain region of the genome.

  • filter determines what subset of the data needs to be processed in each task. In our example, the program lists all the reference positions in our region of interest.

  • map applies the function, i.e. performs the analysis on each subset of data. In our example, for each position in the list, the program looks into the BAM file, pulls out the pileup of bases and outputs the depth of coverage at that position.

  • reduce combines the elements in the list of results output by the map function. In our example, the program takes the coverage numbers that were calculated separately for all the reference positions and calculates their average, which is the final result we want.

This may seem trivial for such a simple example, but it is a very powerful method with many advantages. Among other things, it makes it relatively easy to parallelize operations, which makes the tools run much faster on large datasets.

Walkers, filters and traversal types

All the tools in the GATK are built from the ground up to take advantage of this method. That’s why we call them walkers: because they “walk” across the genome, getting things done.

Note that even though it’s not included in the Map/Reduce technique’s name, the filter step is very important. It determines what data get presented to the tool for analysis, selecting only the appropriate data for each task and discarding anything that’s not relevant. This is a key part of the Map/Reduce technique, because that’s what makes each task “bite-sized” enough for the computer to handle easily.

Each tool has filters that are tailored specifically for the type of analysis it performs. The filters rely on traversal engines, which are little programs that are designed to “traverse” the data (i.e. walk through the data) in specific ways.

There are three major types of traversal: Locus Traversal, Read Traversal and Active Region Traversal. In our interval coverage example, the tool’s filter uses the Locus Traversal engine, which walks through the data by locus, i.e. by position along the reference genome. Because of that, the tool is classified as a Locus Walker. Similarly, the Read Traversal engine is used, you’ve guessed it, by Read Walkers.

The GATK engine comes packed with many other ways to walk through the genome and get the job done seamlessly, but those are the ones you’ll encounter most often.

Further reading

A primer on parallelism with the GATK How can I use parallelism to make GATK tools run faster?

1. Obtaining the bundle

Inside of the Broad, the latest bundle will always be available in:

/humgen/gsa-hpprojects/GATK/bundle/current

with a subdirectory containing for each reference sequence and associated data files.

External users can download these files (or corresponding .gz versions) from the GSA FTP Server in the directory bundle. Gzipped files should be unzipped before attempting to use them. Note that there is no "current link" on the FTP; users should download the highest numbered directory under current (this is the most recent data set).

2. b37 Resources: the Standard Data Set

  • Reference sequence (standard 1000 Genomes fasta) along with fai and dict files
  • dbSNP in VCF. This includes two files:
    • The most recent dbSNP release
    • This file subsetted to only sites discovered in or before dbSNPBuildID 129, which excludes the impact of the 1000 Genomes project and is useful for evaluation of dbSNP rate and Ti/Tv values at novel sites.
  • HapMap genotypes and sites VCFs
  • OMNI 2.5 genotypes for 1000 Genomes samples, as well as sites, VCF
  • The current best set of known indels to be used for local realignment (note that we don't use dbSNP for this anymore); use both files:
    • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)
    • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • A large-scale standard single sample BAM file for testing:
    • NA12878.HiSeq.WGS.bwa.cleaned.recal.hg19.20.bam containing ~64x reads of NA12878 on chromosome 20
    • The results of the latest UnifiedGenotyper with default arguments run on this data set (NA12878.HiSeq.WGS.bwa.cleaned.recal.hg19.20.vcf)

Additionally, these files all have supplementary indices, statistics, and other QC data available.

3. hg18 Resources: lifted over from b37

Includes the UCSC-style hg18 reference along with all lifted over VCF files. The refGene track and BAM files are not available. We only provide data files for this genome-build that can be lifted over "easily" from our master b37 repository. Sorry for whatever inconvenience that this might cause.

Also includes a chain file to lift over to b37.

4. b36 Resources: lifted over from b37

Includes the 1000 Genomes pilot b36 formated reference sequence (human_b36_both.fasta) along with all lifted over VCF files. The refGene track and BAM files are not available. We only provide data files for this genome-build that can be lifted over "easily" from our master b37 repository. Sorry for whatever inconvenience that this might cause.

Also includes a chain file to lift over to b37.

5. hg19 Resources: lifted over from b37

Includes the UCSC-style hg19 reference along with all lifted over VCF files.