Tagged with #validation
3 documentation articles | 0 events or announcements | 1 forum discussion


Creating Amplicon Sequences

Note that earlier versions of the GATK used a different tool.

For a complete, detailed argument reference, refer to the GATK document page here

Contents

Introduction

This tool generates amplicon sequences for use with the Sequenom primer design tool. The output of this tool is fasta-formatted, where the characters [A/B] specify the allele to be probed (see Validation Amplicons Output further below). It can mask nearby variation (either by 'N' or by lower-casing characters), and can try to restrict sequenom design to regions of the amplicon likely to generate a highly specific primer. This tool will also flag sites with properties that could shift the mass-spec peak from its expected value, such as indels in the amplicon sequence, SNPs within 4 bases of the variant attempting to be probed, or multiple variants selected for validation falling into the same amplicon.

Lowercase and Ns

Ns in the amplicon sequence instructs primer design software (such as Sequenom) not to use that base in the primer: any primer will fall entirely before, or entirely after, that base. Lower-case letters instruct the design software to try to avoid using the base (presumably by applying a penalty for doing so), but will not prevent it from doing so if a good primer (i.e. a primer with suitable melting temperature and low probability of hairpin formation) is found.

BWA Bindings

ValidationAmplicons relies on the GATK Sting BWA/C bindings to assess the specificity of potential primers. The wiki page for Sting BWA/C bindings contains required information about how to download the appropriate version of BWA, how to create a BWT reference, and how to set your classpath appropriately to run this tool. If you have not followed the directions to set up the BWA/C bindings, you will not be able to create validation amplicon sequences using the GATK. There is an argument (see below) to disable the use of BWA, and lower repeats within the amplicon only. Use of this argument is not recommended.

Running Validation Amplicons

Validation Amplicons requires three input files: a VCF of alleles you want to validate, a VCF of variants you want to mask, and a Table of intervals around the variants describing the size of the amplicons. For instance:

Alleles to Validate

##fileformat=VCFv4.0
#CHROM      POS     ID      REF     ALT     QUAL    FILTER  INFO
20          207414  .       G    A       85.09   PASS    .   // SNP to validate
20          792122  .    TCCC    T       22.24   PASS    .   // DEL to validate
20          994145  .       G    GAAG    48.21   PASS    .   // INS to validate
20          1074230 .       C    T       2.29     QD     .   // SNP to validate (but filtered)
20          1084330 .      AC   GT       42.21   PASS    .   // MNP to validate 

Interval Table

HEADERpos               name
20:207334-207494        20_207414
20:792042-792202        20_792122
20:994065-994225        20_994145
20:1074150-1074310      20_1074230
20:1084250-1084410      20_1084330

Alleles to Mask

##fileformat=VCFv4.1
#CHROM  POS      ID        REF         ALT     QUAL       FILTER         INFO
20      207414   .         G           A       77.12      PASS            .
20      207416   .         A           AGGC    49422.34   PASS            .
20      792076   .         A           G       2637.15    HaplotypeScore  .
20      792080   .         T           G       161.83     PASS            .
20      792087   .         CGGT        C       179.84     ReadPosRankSum  .
20      792106   .         C           G       32.59      PASS            .
20      792140   .         C           G       409.75     PASS            .
20      1084319  .         T          A,C      22.24      PASS            .
20      1084348  .  TACCACCCCACACA     T      482.84      PASS            .

Validation Amplicons Output

The output from Validation Amplicons is a fasta-formatted file, with a small adaptation to represent the site being probed. Using the test files above, the output of the command

java -jar $GATK/dist/GenomeAnalysisTK.jar \
-T ValidationAmplicons \
-R /humgen/1kg/reference/human_g1k_v37.fasta \
-BTI ProbeIntervals \
--ProbeIntervals:table interval_table.table \
--ValidateAlleles:vcf sites_to_validate.vcf \
--MaskAlleles:vcf mask_sites.vcf \
--virtualPrimerSize 30 \
-o probes.fasta \
-l WARN

is

>20:207414 INSERTION=1,VARIANT_TOO_NEAR_PROBE=1, 20_207414
CCAACGTTAAGAAAGAGACATGCGACTGGGTgcggtggctcatgcctggaaccccagcactttgggaggccaaggtgggc[A/G*]gNNcacttgaggtcaggagtttgagaccagcctggccaacatggtgaaaccccgtctctactgaaaatacaaaagttagC
>20:792122 Valid 20_792122
TTTTTTTTTagatggagtctcgctcttatcgcccaggcNggagtgggtggtgtgatcttggctNactgcaacttctgcct[-/CCC*]cccaggttcaagtgattNtcctgcctcagccacctgagtagctgggattacaggcatccgccaccatgcctggctaatTT
>20:994145 Valid 20_994145
TCCATGGCCTCCCCCTGGCCCACGAAGTCCTCAGCCACCTCCTTCCTGGAGGGCTCAGCCAAAATCAGACTGAGGAAGAAG[AAG/-*]TGGTGGGCACCCACCTTCTGGCCTTCCTCAGCCCCTTATTCCTAGGACCAGTCCCCATCTAGGGGTCCTCACTGCCTCCC
>20:1074230 SITE_IS_FILTERED=1, 20_1074230
ACCTGATTACCATCAATCAGAACTCATTTCTGTTCCTATCTTCCACCCACAATTGTAATGCCTTTTCCATTTTAACCAAG[T/C*]ACTTATTATAtactatggccataacttttgcagtttgaggtatgacagcaaaaTTAGCATACATTTCATTTTCCTTCTTC
>20:1084330 DELETION=1, 20_1084330
CACGTTCGGcttgtgcagagcctcaaggtcatccagaggtgatAGTTTAGGGCCCTCTCAAGTCTTTCCNGTGCGCATGG[GT/AC*]CAGCCCTGGGCACCTGTNNNNNNNNNNNNNTGCTCATGGCCTTCTAGATTCCCAGGAAATGTCAGAGCTTTTCAAAGCCC

Note that SNPs have been masked with 'N's, filtered 'mask' variants do not appear, the insertion has been flanked by Ns, the unfiltered deletion has been replaced by Ns, and the filtered site in the validation VCF is not marked as valid. In addition, bases that fall inside at least one non-unique 30-mer (meaning no multiple MQ0 alignments using BWA) are lower-cased. The identifier for each sequence is the position of the allele to be probed, a 'validation status' (defined below), and a string representing the amplicon. Validation status values are:

Valid                     // amplicon is valid
SITE_IS_FILTERED=1        // validation site is not marked 'PASS' or '.' in its filter field ("you are trying to validate a filtered variant")
VARIANT_TOO_NEAR_PROBE=1  // there is a variant too near to the variant to be validated, potentially shifting the mass-spec peak
MULTIPLE_PROBES=1,        // multiple variants to be validated found inside the same amplicon
DELETION=6,INSERTION=5,   // 6 deletions and 5 insertions found inside the amplicon region (from the "mask" VCF), will be potentially difficult to validate
DELETION=1,               // deletion found inside the amplicon region, could shift mass-spec peak
START_TOO_CLOSE,          // variant is too close to the start of the amplicon region to give sequenom a good chance to find a suitable primer
END_TOO_CLOSE,            // variant is too close to the end of the amplicon region to give sequenom a good chance to find a suitable primer
NO_VARIANTS_FOUND,        // no variants found within the amplicon region
INDEL_OVERLAPS_VALIDATION_SITE, // an insertion or deletion interferes directly with the site to be validated (i.e. insertion directly preceding or postceding, or a deletion that spans the site itself)

Warnings During Traversal

The files provided to Validation Amplicons should be such that all generated amplicons are valid. That means:

There are no variants within 4bp of the site to be validated
There are no indels in the amplicon region
Amplicon windows do not include other sites to be probed
Amplicon windows are not too short, and the variant therein is not within 50bp of either edge
All amplicon windows contain a variant to be validated
Variants to be validated are unfiltered or pass filters

The tool will warn you each time any of these conditions are not met.

Contents

Introduction

ValidationSiteSelectorWalker is intended for use in experiments where we sample data randomly from a set of variants, for example in order to choose sites for a follow-up validation study. Sites are selected randomly but within certain restrictions. There are two main sources of restrictions: Sample restrictions and Frequency restrictions. Sample restrictions alter the polymorphic/monomorphic status of sites by restricting the sample set to a given number of samples. Frequency restrictions bias the site sampling method to sample either uniformly, or in accordance with the allele frequency spectrum of the input VCF.

GATK Documentation

For example command lines and a full list of arguments, please see the GATK documentation for this tool at Validation Site Selector.

Sample and Frequency Restrictions

-sampleMode

The -sampleMode argument controls the mode of sample-based site consideration. The options are:

  • None: All sites are included for consideration, including reference sites
  • Poly_based_on_gt: Site is included if it has a variant genotype in at least one of the selected samples
  • Poly_based_on_gl: Site is included if it is likely to be variant based on the genotype likelihoods of the selected samples

-samplePNonref

Note that Poly_based_on_gl uses the exact allele frequency calculation model to estimate P[site is nonref]. The site is considered for validation if P[site is nonref] > [this argument]. So if you want to validate sites that are >95% confidently nonref (based on the likelihoods), you would set -sampleMode POLY_BASED_ON_GL -samplePNonref 0.95

-frequencySelectionMode

The -frequencySelectionMode argument controls the mode of frequency matching for site selection. The options are:

  • Uniform: Choose variants uniformly, without regard to their allele frequency.
  • Keep AF Spectrum: Choose variants so that the resulting allele frequency matches as closely as possible to that of the input VCF.

Introduction

Genotype and Validate is a tool to asses the quality of a technology dataset for calling SNPs and Indels given a secondary (validation) datasource.

The simplest scenario is when you have a VCF of hand annotated SNPs and Indels, and you want to know how well a particular technology performs calling these snps. With a dataset (BAM file) generated by the technology in test, and the hand annotated VCF, you can run GenotypeAndValidate to asses the accuracy of the calls with the new technology's dataset.

Another option is to validate the calls on a VCF file, using a deep coverage BAM file that you trust the calls on. The GenotypeAndValidate walker will make calls using the reads in the BAM file and take them as truth, then compare to the calls in the VCF file and produce a truth table.

Command-line arguments

Usage of GenotypeAndValidate and its command line arguments are described here.

The VCF Annotations

The annotations can be either true positive (T) or false positive (F). 'T' means it is known to be a true SNP/Indel, while a 'F' means it is known not to be a SNP/Indel but the technology used to create the VCF calls it. To annotate the VCF, simply add an INFO field GV with the value T or F.

The Outputs

GenotypeAndValidate has two outputs. The truth table and the optional VCF file. The truth table is a 2x2 table correlating what was called in the dataset with the truth of the call (whether it's a true positive or a false positive). The table should look like this:

ALT REF Predictive Value
called alt True Positive (TP) False Positive (FP) Positive PV
called ref False Negative (FN) True Negative (TN) Negative PV

The positive predictive value (PPV) is the proportion of subjects with positive test results who are correctly diagnose.

The negative predictive value (NPV) is the proportion of subjects with a negative test result who are correctly diagnosed.

The optional VCF file will contain only the variants that were called or not called, excluding the ones that were uncovered or didn't pass the filters (-depth). This file is useful if you are trying to compare the PPV and NPV of two different technologies on the exact same sites (so you can compare apples to apples).

Additional Details

  • You should always use -BTI alleles, so that the GATK only looks at the sites on the VCF file, speeds up the process a lot. (this will soon be added as a default gatk engine mode)

  • The total number of visited bases may be greater than the number of variants in the original VCF file because of extended indels, as they trigger one call per new insertion or deletion. (i.e. ACTG/- will count as 4 genotyper calls, but it's only one line in the VCF).

Examples

Genotypes BAM file from new technology using the VCF as a truth dataset:

java \
    -jar /GenomeAnalysisTK.jar \
    -T  GenotypeAndValidate \
    -R human_g1k_v37.fasta \
    -I myNewTechReads.bam \
    -alleles handAnnotatedVCF.vcf \
    -BTI alleles \
    -o gav.vcf

An annotated VCF example (info field clipped for clarity)

#CHROM  POS ID  REF ALT QUAL    FILTER  INFO    FORMAT  NA12878
1   20568807    .   C   T   0    HapMapHet        AC=1;AF=0.50;AN=2;DP=0;GV=T  GT  0/1
1   22359922    .   T   C   282  WG-CG-HiSeq      AC=2;AF=0.50;GV=T;AN=4;DP=42 GT:AD:DP:GL:GQ  1/0 ./. 0/1:20,22:39:-72.79,-11.75,-67.94:99    ./.
13  102391461   .   G   A   341  Indel;SnpCluster AC=1;GV=F;AF=0.50;AN=2;DP=45 GT:AD:DP:GL:GQ  ./. ./. 0/1:32,13:45:-50.99,-13.56,-112.17:99   ./.
1   175516757   .   C   G   655  SnpCluster,WG    AC=1;AF=0.50;AN=2;GV=F;DP=74 GT:AD:DP:GL:GQ  ./. ./. 0/1:52,22:67:-89.02,-20.20,-191.27:99   ./.

Using a BAM file as the truth dataset:

java \
    -jar /GenomeAnalysisTK.jar \
    -T  GenotypeAndValidate \
    -R human_g1k_v37.fasta \
    -I myTruthDataset.bam \
    -alleles callsToValidate.vcf \
    -BTI alleles \
    -bt \
    -o gav.vcf

Example truth table of PacBio reads (BAM) to validate HiSeq annotated dataset (VCF) using the GenotypeAndValidate walker:

PacBio PbGenotypeAndValidate results

Sorry, there are no publicly available documents of this type with the tag #validation. Try one of the other types.

Hi all, I've somewhere in this site that before VQSR the FP rate is expected to be around 10% (I guess for UnifiedGenotyper). Are there some updated statistics for VQRS? For HaplotypeCaller? For Exome/WG data? Another thing: we apply VQRS on all our analysis, we are trying to collect some validation statistics. We suspect that most of the FP have some particular "culprits" in VQRS (especially QD and MQ). Do you have some data about this? Best

d