Tagged with #methods
9 documentation articles | 0 events or announcements | 0 forum discussions


Detailed information about command line options for BaseRecalibrator can be found here.

Introduction

The tools in this package recalibrate base quality scores of sequencing-by-synthesis reads in an aligned BAM file. After recalibration, the quality scores in the QUAL field in each read in the output BAM are more accurate in that the reported quality score is closer to its actual probability of mismatching the reference genome. Moreover, the recalibration tool attempts to correct for variation in quality with machine cycle and sequence context, and by doing so provides not only more accurate quality scores but also more widely dispersed ones. The system works on BAM files coming from many sequencing platforms: Illumina, SOLiD, 454, Complete Genomics, Pacific Biosciences, etc.

New with the release of the full version of GATK 2.0 is the ability to recalibrate not only the well-known base quality scores but also base insertion and base deletion quality scores. These are per-base quantities which estimate the probability that the next base in the read was mis-incorporated or mis-deleted (due to slippage, for example). We've found that these new quality scores are very valuable in indel calling algorithms. In particular these new probabilities fit very naturally as the gap penalties in an HMM-based indel calling algorithms. We suspect there are many other fantastic uses for these data.

This process is accomplished by analyzing the covariation among several features of a base. For example:

  • Reported quality score
  • The position within the read
  • The preceding and current nucleotide (sequencing chemistry effect) observed by the sequencing machine

These covariates are then subsequently applied through a piecewise tabular correction to recalibrate the quality scores of all reads in a BAM file.

For example, pre-calibration a file could contain only reported Q25 bases, which seems good. However, it may be that these bases actually mismatch the reference at a 1 in 100 rate, so are actually Q20. These higher-than-empirical quality scores provide false confidence in the base calls. Moreover, as is common with sequencing-by-synthesis machine, base mismatches with the reference occur at the end of the reads more frequently than at the beginning. Also, mismatches are strongly associated with sequencing context, in that the dinucleotide AC is often much lower quality than TG. The recalibration tool will not only correct the average Q inaccuracy (shifting from Q25 to Q20) but identify subsets of high-quality bases by separating the low-quality end of read bases AC bases from the high-quality TG bases at the start of the read. See below for examples of pre and post corrected values.

The system was designed for users to be able to easily add new covariates to the calculations. For users wishing to add their own covariate simply look at QualityScoreCovariate.java for an idea of how to implement the required interface. Each covariate is a Java class which implements the org.broadinstitute.sting.gatk.walkers.recalibration.Covariate interface. Specifically, the class needs to have a getValue method defined which looks at the read and associated sequence context and pulls out the desired information such as machine cycle.

Running the tools

BaseRecalibrator

Detailed information about command line options for BaseRecalibrator can be found here.

This GATK processing step walks over all of the reads in my_reads.bam and tabulates data about the following features of the bases:

  • read group the read belongs to
  • assigned quality score
  • machine cycle producing this base
  • current base + previous base (dinucleotide)

For each bin, we count the number of bases within the bin and how often such bases mismatch the reference base, excluding loci known to vary in the population, according to dbSNP. After running over all reads, BaseRecalibrator produces a file called my_reads.recal_data.grp, which contains the data needed to recalibrate reads. The format of this GATK report is described below.

Creating a recalibrated BAM

To create a recalibrated BAM you can use GATK's PrintReads with the engine on-the-fly recalibration capability. Here is a typical command line to do so:

 
java -jar GenomeAnalysisTK.jar \
   -T PrintReads \
   -R reference.fasta \
   -I input.bam \
   -BQSR recalibration_report.grp \
   -o output.bam

After computing covariates in the initial BAM File, we then walk through the BAM file again and rewrite the quality scores (in the QUAL field) using the data in the recalibration_report.grp file, into a new BAM file.

This step uses the recalibration table data in recalibration_report.grp produced by BaseRecalibration to recalibrate the quality scores in input.bam, and writing out a new BAM file output.bam with recalibrated QUAL field values.

Effectively the new quality score is:

  • the sum of the global difference between reported quality scores and the empirical quality
  • plus the quality bin specific shift
  • plus the cycle x qual and dinucleotide x qual effect

Following recalibration, the read quality scores are much closer to their empirical scores than before. This means they can be used in a statistically robust manner for downstream processing, such as SNP calling. In additional, by accounting for quality changes by cycle and sequence context, we can identify truly high quality bases in the reads, often finding a subset of bases that are Q30 even when no bases were originally labeled as such.

Miscellaneous information

  • The recalibration system is read-group aware. It separates the covariate data by read group in the recalibration_report.grp file (using @RG tags) and PrintReads will apply this data for each read group in the file. We routinely process BAM files with multiple read groups. Please note that the memory requirements scale linearly with the number of read groups in the file, so that files with many read groups could require a significant amount of RAM to store all of the covariate data.
  • A critical determinant of the quality of the recalibation is the number of observed bases and mismatches in each bin. The system will not work well on a small number of aligned reads. We usually expect well in excess of 100M bases from a next-generation DNA sequencer per read group. 1B bases yields significantly better results.
  • Unless your database of variation is so poor and/or variation so common in your organism that most of your mismatches are real snps, you should always perform recalibration on your bam file. For humans, with dbSNP and now 1000 Genomes available, almost all of the mismatches - even in cancer - will be errors, and an accurate error model (essential for downstream analysis) can be ascertained.
  • The recalibrator applies a "yates" correction for low occupancy bins. Rather than inferring the true Q score from # mismatches / # bases we actually infer it from (# mismatches + 1) / (# bases + 2). This deals very nicely with overfitting problems, which has only a minor impact on data sets with billions of bases but is critical to avoid overconfidence in rare bins in sparse data.

Example pre and post recalibration results

  • Recalibration of a lane sequenced at the Broad by an Illumina GA-II in February 2010
  • There is a significant improvement in the accuracy of the base quality scores after applying the GATK recalibration procedure

The output of the BaseRecalibrator walker

  • A Recalibration report containing all the recalibration information for the data
  • A PDF file containing quality control plots showing the patterns of recalibration of the data
  • A temporary csv file to generate the plots (this file is automatically removed unless you provide the -k options to keep it)

The Recalibration Report

The recalibration report is a [GATKReport](http://gatk.vanillaforums.com/discussion/1244/what-is-a-gatkreport) and not only contains the main result of the analysis, but it is also used as an input to all subsequent analyses on the data. The recalibration report contains the following 5 tables:

  • Arguments Table -- a table with all the arguments and its values
  • Quantization Table
  • ReadGroup Table
  • Quality Score Table
  • Covariates Table

Arguments Table

This is the table that contains all the arguments used to run BQSRv2 for this dataset. This is important for the on-the-fly recalibration step to use the same parameters used in the recalibration step (context sizes, covariates, ...).

Example Arguments table:

 
#:GATKTable:true:1:17::;
#:GATKTable:Arguments:Recalibration argument collection values used in this run
Argument                    Value
covariate                   null
default_platform            null
deletions_context_size      6
force_platform              null
insertions_context_size     6
...

Quantization Table

The GATK offers native support to quantize base qualities. The GATK quantization procedure uses a statistical approach to determine the best binning system that minimizes the error introduced by amalgamating the different qualities present in the specific dataset. When running BQSRv2, a table with the base counts for each base quality is generated and a 'default' quantization table is generated. This table is a required parameter for any other tool in the GATK if you want to quantize your quality scores.

The default behavior (currently) is to use no quantization when performing on-the-fly recalibration. You can override this by using the engine argument -qq. With -qq 0 you don't quantize qualities, or -qq N you recalculate the quantization bins using N bins on the fly. Note that quantization is completely experimental now and we do not recommend using it unless you are a super advanced user.

Example Arguments table:

 
#:GATKTable:true:2:94:::;
#:GATKTable:Quantized:Quality quantization map
QualityScore  Count        QuantizedScore
0                     252               0
1                   15972               1
2                  553525               2
3                 2190142               9
4                 5369681               9
9                83645762               9
...

ReadGroup Table

This table contains the empirical quality scores for each read group, for mismatches insertions and deletions. This is not different from the table used in the old table recalibration walker.

 
#:GATKTable:false:6:18:%s:%s:%.4f:%.4f:%d:%d:;
#:GATKTable:RecalTable0:
ReadGroup  EventType  EmpiricalQuality  EstimatedQReported  Observations  Errors
SRR032768  D                   40.7476             45.0000    2642683174    222475
SRR032766  D                   40.9072             45.0000    2630282426    213441
SRR032764  D                   40.5931             45.0000    2919572148    254687
SRR032769  D                   40.7448             45.0000    2850110574    240094
SRR032767  D                   40.6820             45.0000    2820040026    241020
SRR032765  D                   40.9034             45.0000    2441035052    198258
SRR032766  M                   23.2573             23.7733    2630282426  12424434
SRR032768  M                   23.0281             23.5366    2642683174  13159514
SRR032769  M                   23.2608             23.6920    2850110574  13451898
SRR032764  M                   23.2302             23.6039    2919572148  13877177
SRR032765  M                   23.0271             23.5527    2441035052  12158144
SRR032767  M                   23.1195             23.5852    2820040026  13750197
SRR032766  I                   41.7198             45.0000    2630282426    177017
SRR032768  I                   41.5682             45.0000    2642683174    184172
SRR032769  I                   41.5828             45.0000    2850110574    197959
SRR032764  I                   41.2958             45.0000    2919572148    216637
SRR032765  I                   41.5546             45.0000    2441035052    170651
SRR032767  I                   41.5192             45.0000    2820040026    198762

Quality Score Table

This table contains the empirical quality scores for each read group and original quality score, for mismatches insertions and deletions. This is not different from the table used in the old table recalibration walker.

 
#:GATKTable:false:6:274:%s:%s:%s:%.4f:%d:%d:;
#:GATKTable:RecalTable1:
ReadGroup  QualityScore  EventType  EmpiricalQuality  Observations  Errors
SRR032767            49  M                   33.7794          9549        3
SRR032769            49  M                   36.9975          5008        0
SRR032764            49  M                   39.2490          8411        0
SRR032766            18  M                   17.7397      16330200   274803
SRR032768            18  M                   17.7922      17707920   294405
SRR032764            45  I                   41.2958    2919572148   216637
SRR032765             6  M                    6.0600       3401801   842765
SRR032769            45  I                   41.5828    2850110574   197959
SRR032764             6  M                    6.0751       4220451  1041946
SRR032767            45  I                   41.5192    2820040026   198762
SRR032769             6  M                    6.3481       5045533  1169748
SRR032768            16  M                   15.7681      12427549   329283
SRR032766            16  M                   15.8173      11799056   309110
SRR032764            16  M                   15.9033      13017244   334343
SRR032769            16  M                   15.8042      13817386   363078
...

Covariates Table

This table has the empirical qualities for each covariate used in the dataset. The default covariates are cycle and context. In the current implementation, context is of a fixed size (default 6). Each context and each cycle will have an entry on this table stratified by read group and original quality score.

 
#:GATKTable:false:8:1003738:%s:%s:%s:%s:%s:%.4f:%d:%d:;
#:GATKTable:RecalTable2:
ReadGroup  QualityScore  CovariateValue  CovariateName  EventType  EmpiricalQuality  Observations  Errors
SRR032767            16  TACGGA          Context        M                   14.2139           817      30
SRR032766            16  AACGGA          Context        M                   14.9938          1420      44
SRR032765            16  TACGGA          Context        M                   15.5145           711      19
SRR032768            16  AACGGA          Context        M                   15.0133          1585      49
SRR032764            16  TACGGA          Context        M                   14.5393           710      24
SRR032766            16  GACGGA          Context        M                   17.9746          1379      21
SRR032768            45  CACCTC          Context        I                   40.7907        575849      47
SRR032764            45  TACCTC          Context        I                   43.8286        507088      20
SRR032769            45  TACGGC          Context        D                   38.7536         37525       4
SRR032768            45  GACCTC          Context        I                   46.0724        445275      10
SRR032766            45  CACCTC          Context        I                   41.0696        575664      44
SRR032769            45  TACCTC          Context        I                   43.4821        490491      21
SRR032766            45  CACGGC          Context        D                   45.1471         65424       1
SRR032768            45  GACGGC          Context        D                   45.3980         34657       0
SRR032767            45  TACGGC          Context        D                   42.7663         37814       1
SRR032767            16  AACGGA          Context        M                   15.9371          1647      41
SRR032764            16  GACGGA          Context        M                   18.2642          1273      18
SRR032769            16  CACGGA          Context        M                   13.0801          1442      70
SRR032765            16  GACGGA          Context        M                   15.9934          1271      31
...

Troubleshooting

The memory requirements of the recalibrator will vary based on the type of JVM running the application and the number of read groups in the input bam file.

If the application reports 'java.lang.OutOfMemoryError: Java heap space', increase the max heap size provided to the JVM by adding ' -Xmx????m' to the jvm_args variable in RecalQual.py, where '????' is the maximum available memory on the processing computer.

I've tried recalibrating my data using a downloaded file, such as NA12878 on 454, and apply the table to any of the chromosome BAM files always fails due to hitting my memory limit. I've tried giving it as much as 15GB but that still isn't enough.

All of our big merged files for 454 are running with -Xmx16000m arguments to the JVM -- it's enough to process all of the files. 32GB might make the 454 runs a lot faster though.

I have a recalibration file calculated over the entire genome (such as for the 1000 genomes trio) but I split my file into pieces (such as by chromosome). Can the recalibration tables safely be applied to the per chromosome BAM files?

Yes they can. The original tables needed to be calculated over the whole genome but they can be applied to each piece of the data set independently.

I'm working on a genome that doesn't really have a good SNP database yet. I'm wondering if it still makes sense to run base quality score recalibration without known SNPs.

The base quality score recalibrator treats every reference mismatch as indicative of machine error. True polymorphisms are legitimate mismatches to the reference and shouldn't be counted against the quality of a base. We use a database of known polymorphisms to skip over most polymorphic sites. Unfortunately without this information the data becomes almost completely unusable since the quality of the bases will be inferred to be much much lower than it actually is as a result of the reference-mismatching SNP sites.

However, all is not lost if you are willing to experiment a bit. You can bootstrap a database of known SNPs. Here's how it works:

  • First do an initial round of SNP calling on your original, unrecalibrated data.
  • Then take the SNPs that you have the highest confidence in and use that set as the database of known SNPs by feeding it as a VCF file to the base quality score recalibrator.
  • Finally, do a real round of SNP calling with the recalibrated data. These steps could be repeated several times until convergence.

Downsampling to reduce run time

For users concerned about run time please note this small analysis below showing the approximate number of reads per read group that are required to achieve a given level of recalibration performance. The analysis was performed with 51 base pair Illumina reads on pilot data from the 1000 Genomes Project. Downsampling can be achieved by specifying a genome interval using the -L option. For users concerned only with recalibration accuracy please disregard this plot and continue to use all available data when generating the recalibration table.

Creating Amplicon Sequences

Note that earlier versions of the GATK used a different tool.

For a complete, detailed argument reference, refer to the GATK document page here

Contents

Introduction

This tool generates amplicon sequences for use with the Sequenom primer design tool. The output of this tool is fasta-formatted, where the characters [A/B] specify the allele to be probed (see Validation Amplicons Output further below). It can mask nearby variation (either by 'N' or by lower-casing characters), and can try to restrict sequenom design to regions of the amplicon likely to generate a highly specific primer. This tool will also flag sites with properties that could shift the mass-spec peak from its expected value, such as indels in the amplicon sequence, SNPs within 4 bases of the variant attempting to be probed, or multiple variants selected for validation falling into the same amplicon.

Lowercase and Ns

Ns in the amplicon sequence instructs primer design software (such as Sequenom) not to use that base in the primer: any primer will fall entirely before, or entirely after, that base. Lower-case letters instruct the design software to try to avoid using the base (presumably by applying a penalty for doing so), but will not prevent it from doing so if a good primer (i.e. a primer with suitable melting temperature and low probability of hairpin formation) is found.

BWA Bindings

ValidationAmplicons relies on the GATK Sting BWA/C bindings to assess the specificity of potential primers. The wiki page for Sting BWA/C bindings contains required information about how to download the appropriate version of BWA, how to create a BWT reference, and how to set your classpath appropriately to run this tool. If you have not followed the directions to set up the BWA/C bindings, you will not be able to create validation amplicon sequences using the GATK. There is an argument (see below) to disable the use of BWA, and lower repeats within the amplicon only. Use of this argument is not recommended.

Running Validation Amplicons

Validation Amplicons requires three input files: a VCF of alleles you want to validate, a VCF of variants you want to mask, and a Table of intervals around the variants describing the size of the amplicons. For instance:

Alleles to Validate

##fileformat=VCFv4.0
#CHROM      POS     ID      REF     ALT     QUAL    FILTER  INFO
20          207414  .       G    A       85.09   PASS    .   // SNP to validate
20          792122  .    TCCC    T       22.24   PASS    .   // DEL to validate
20          994145  .       G    GAAG    48.21   PASS    .   // INS to validate
20          1074230 .       C    T       2.29     QD     .   // SNP to validate (but filtered)
20          1084330 .      AC   GT       42.21   PASS    .   // MNP to validate 

Interval Table

HEADERpos               name
20:207334-207494        20_207414
20:792042-792202        20_792122
20:994065-994225        20_994145
20:1074150-1074310      20_1074230
20:1084250-1084410      20_1084330

Alleles to Mask

##fileformat=VCFv4.1
#CHROM  POS      ID        REF         ALT     QUAL       FILTER         INFO
20      207414   .         G           A       77.12      PASS            .
20      207416   .         A           AGGC    49422.34   PASS            .
20      792076   .         A           G       2637.15    HaplotypeScore  .
20      792080   .         T           G       161.83     PASS            .
20      792087   .         CGGT        C       179.84     ReadPosRankSum  .
20      792106   .         C           G       32.59      PASS            .
20      792140   .         C           G       409.75     PASS            .
20      1084319  .         T          A,C      22.24      PASS            .
20      1084348  .  TACCACCCCACACA     T      482.84      PASS            .

Validation Amplicons Output

The output from Validation Amplicons is a fasta-formatted file, with a small adaptation to represent the site being probed. Using the test files above, the output of the command

java -jar $GATK/dist/GenomeAnalysisTK.jar \
-T ValidationAmplicons \
-R /humgen/1kg/reference/human_g1k_v37.fasta \
-BTI ProbeIntervals \
--ProbeIntervals:table interval_table.table \
--ValidateAlleles:vcf sites_to_validate.vcf \
--MaskAlleles:vcf mask_sites.vcf \
--virtualPrimerSize 30 \
-o probes.fasta \
-l WARN

is

>20:207414 INSERTION=1,VARIANT_TOO_NEAR_PROBE=1, 20_207414
CCAACGTTAAGAAAGAGACATGCGACTGGGTgcggtggctcatgcctggaaccccagcactttgggaggccaaggtgggc[A/G*]gNNcacttgaggtcaggagtttgagaccagcctggccaacatggtgaaaccccgtctctactgaaaatacaaaagttagC
>20:792122 Valid 20_792122
TTTTTTTTTagatggagtctcgctcttatcgcccaggcNggagtgggtggtgtgatcttggctNactgcaacttctgcct[-/CCC*]cccaggttcaagtgattNtcctgcctcagccacctgagtagctgggattacaggcatccgccaccatgcctggctaatTT
>20:994145 Valid 20_994145
TCCATGGCCTCCCCCTGGCCCACGAAGTCCTCAGCCACCTCCTTCCTGGAGGGCTCAGCCAAAATCAGACTGAGGAAGAAG[AAG/-*]TGGTGGGCACCCACCTTCTGGCCTTCCTCAGCCCCTTATTCCTAGGACCAGTCCCCATCTAGGGGTCCTCACTGCCTCCC
>20:1074230 SITE_IS_FILTERED=1, 20_1074230
ACCTGATTACCATCAATCAGAACTCATTTCTGTTCCTATCTTCCACCCACAATTGTAATGCCTTTTCCATTTTAACCAAG[T/C*]ACTTATTATAtactatggccataacttttgcagtttgaggtatgacagcaaaaTTAGCATACATTTCATTTTCCTTCTTC
>20:1084330 DELETION=1, 20_1084330
CACGTTCGGcttgtgcagagcctcaaggtcatccagaggtgatAGTTTAGGGCCCTCTCAAGTCTTTCCNGTGCGCATGG[GT/AC*]CAGCCCTGGGCACCTGTNNNNNNNNNNNNNTGCTCATGGCCTTCTAGATTCCCAGGAAATGTCAGAGCTTTTCAAAGCCC

Note that SNPs have been masked with 'N's, filtered 'mask' variants do not appear, the insertion has been flanked by Ns, the unfiltered deletion has been replaced by Ns, and the filtered site in the validation VCF is not marked as valid. In addition, bases that fall inside at least one non-unique 30-mer (meaning no multiple MQ0 alignments using BWA) are lower-cased. The identifier for each sequence is the position of the allele to be probed, a 'validation status' (defined below), and a string representing the amplicon. Validation status values are:

Valid                     // amplicon is valid
SITE_IS_FILTERED=1        // validation site is not marked 'PASS' or '.' in its filter field ("you are trying to validate a filtered variant")
VARIANT_TOO_NEAR_PROBE=1  // there is a variant too near to the variant to be validated, potentially shifting the mass-spec peak
MULTIPLE_PROBES=1,        // multiple variants to be validated found inside the same amplicon
DELETION=6,INSERTION=5,   // 6 deletions and 5 insertions found inside the amplicon region (from the "mask" VCF), will be potentially difficult to validate
DELETION=1,               // deletion found inside the amplicon region, could shift mass-spec peak
START_TOO_CLOSE,          // variant is too close to the start of the amplicon region to give sequenom a good chance to find a suitable primer
END_TOO_CLOSE,            // variant is too close to the end of the amplicon region to give sequenom a good chance to find a suitable primer
NO_VARIANTS_FOUND,        // no variants found within the amplicon region
INDEL_OVERLAPS_VALIDATION_SITE, // an insertion or deletion interferes directly with the site to be validated (i.e. insertion directly preceding or postceding, or a deletion that spans the site itself)

Warnings During Traversal

The files provided to Validation Amplicons should be such that all generated amplicons are valid. That means:

There are no variants within 4bp of the site to be validated
There are no indels in the amplicon region
Amplicon windows do not include other sites to be probed
Amplicon windows are not too short, and the variant therein is not within 50bp of either edge
All amplicon windows contain a variant to be validated
Variants to be validated are unfiltered or pass filters

The tool will warn you each time any of these conditions are not met.

Contents

Introduction

ValidationSiteSelectorWalker is intended for use in experiments where we sample data randomly from a set of variants, for example in order to choose sites for a follow-up validation study. Sites are selected randomly but within certain restrictions. There are two main sources of restrictions: Sample restrictions and Frequency restrictions. Sample restrictions alter the polymorphic/monomorphic status of sites by restricting the sample set to a given number of samples. Frequency restrictions bias the site sampling method to sample either uniformly, or in accordance with the allele frequency spectrum of the input VCF.

GATK Documentation

For example command lines and a full list of arguments, please see the GATK documentation for this tool at Validation Site Selector.

Sample and Frequency Restrictions

-sampleMode

The -sampleMode argument controls the mode of sample-based site consideration. The options are:

  • None: All sites are included for consideration, including reference sites
  • Poly_based_on_gt: Site is included if it has a variant genotype in at least one of the selected samples
  • Poly_based_on_gl: Site is included if it is likely to be variant based on the genotype likelihoods of the selected samples

-samplePNonref

Note that Poly_based_on_gl uses the exact allele frequency calculation model to estimate P[site is nonref]. The site is considered for validation if P[site is nonref] > [this argument]. So if you want to validate sites that are >95% confidently nonref (based on the likelihoods), you would set -sampleMode POLY_BASED_ON_GL -samplePNonref 0.95

-frequencySelectionMode

The -frequencySelectionMode argument controls the mode of frequency matching for site selection. The options are:

  • Uniform: Choose variants uniformly, without regard to their allele frequency.
  • Keep AF Spectrum: Choose variants so that the resulting allele frequency matches as closely as possible to that of the input VCF.

Introduction

Genotype and Validate is a tool to asses the quality of a technology dataset for calling SNPs and Indels given a secondary (validation) datasource.

The simplest scenario is when you have a VCF of hand annotated SNPs and Indels, and you want to know how well a particular technology performs calling these snps. With a dataset (BAM file) generated by the technology in test, and the hand annotated VCF, you can run GenotypeAndValidate to asses the accuracy of the calls with the new technology's dataset.

Another option is to validate the calls on a VCF file, using a deep coverage BAM file that you trust the calls on. The GenotypeAndValidate walker will make calls using the reads in the BAM file and take them as truth, then compare to the calls in the VCF file and produce a truth table.

Command-line arguments

Usage of GenotypeAndValidate and its command line arguments are described here.

The VCF Annotations

The annotations can be either true positive (T) or false positive (F). 'T' means it is known to be a true SNP/Indel, while a 'F' means it is known not to be a SNP/Indel but the technology used to create the VCF calls it. To annotate the VCF, simply add an INFO field GV with the value T or F.

The Outputs

GenotypeAndValidate has two outputs. The truth table and the optional VCF file. The truth table is a 2x2 table correlating what was called in the dataset with the truth of the call (whether it's a true positive or a false positive). The table should look like this:

ALT REF Predictive Value
called alt True Positive (TP) False Positive (FP) Positive PV
called ref False Negative (FN) True Negative (TN) Negative PV

The positive predictive value (PPV) is the proportion of subjects with positive test results who are correctly diagnose.

The negative predictive value (NPV) is the proportion of subjects with a negative test result who are correctly diagnosed.

The optional VCF file will contain only the variants that were called or not called, excluding the ones that were uncovered or didn't pass the filters (-depth). This file is useful if you are trying to compare the PPV and NPV of two different technologies on the exact same sites (so you can compare apples to apples).

Additional Details

  • You should always use -BTI alleles, so that the GATK only looks at the sites on the VCF file, speeds up the process a lot. (this will soon be added as a default gatk engine mode)

  • The total number of visited bases may be greater than the number of variants in the original VCF file because of extended indels, as they trigger one call per new insertion or deletion. (i.e. ACTG/- will count as 4 genotyper calls, but it's only one line in the VCF).

Examples

Genotypes BAM file from new technology using the VCF as a truth dataset:

java \
    -jar /GenomeAnalysisTK.jar \
    -T  GenotypeAndValidate \
    -R human_g1k_v37.fasta \
    -I myNewTechReads.bam \
    -alleles handAnnotatedVCF.vcf \
    -BTI alleles \
    -o gav.vcf

An annotated VCF example (info field clipped for clarity)

#CHROM  POS ID  REF ALT QUAL    FILTER  INFO    FORMAT  NA12878
1   20568807    .   C   T   0    HapMapHet        AC=1;AF=0.50;AN=2;DP=0;GV=T  GT  0/1
1   22359922    .   T   C   282  WG-CG-HiSeq      AC=2;AF=0.50;GV=T;AN=4;DP=42 GT:AD:DP:GL:GQ  1/0 ./. 0/1:20,22:39:-72.79,-11.75,-67.94:99    ./.
13  102391461   .   G   A   341  Indel;SnpCluster AC=1;GV=F;AF=0.50;AN=2;DP=45 GT:AD:DP:GL:GQ  ./. ./. 0/1:32,13:45:-50.99,-13.56,-112.17:99   ./.
1   175516757   .   C   G   655  SnpCluster,WG    AC=1;AF=0.50;AN=2;GV=F;DP=74 GT:AD:DP:GL:GQ  ./. ./. 0/1:52,22:67:-89.02,-20.20,-191.27:99   ./.

Using a BAM file as the truth dataset:

java \
    -jar /GenomeAnalysisTK.jar \
    -T  GenotypeAndValidate \
    -R human_g1k_v37.fasta \
    -I myTruthDataset.bam \
    -alleles callsToValidate.vcf \
    -BTI alleles \
    -bt \
    -o gav.vcf

Example truth table of PacBio reads (BAM) to validate HiSeq annotated dataset (VCF) using the GenotypeAndValidate walker:

PacBio PbGenotypeAndValidate results

liftOverVCF.pl

Contents

Introduction

This script converts a VCF file from one reference build to another. It runs 3 modules within our toolkit that are necessary for lifting over a VCF.
1. LiftoverVariants walker
2. sortByRef.pl to sort the lifted-over file
3. Filter out records whose ref field no longer matches the new reference

Obtaining the Script

The liftOverVCF.pl script is available in our public source repository under the 'perl' directory. Instructions for pulling down our source are available here.

Example

./liftOverVCF.pl -vcf calls.b36.vcf \
  -chain b36ToHg19.broad.over.chain \
  -out calls.hg19.vcf \
  -gatk /humgen/gsa-scr1/ebanks/Sting_dev
  -newRef /seq/references/Homo_sapiens_assembly19/v0/Homo_sapiens_assembly19
  -oldRef /humgen/1kg/reference/human_b36_both
  -tmp /broad/shptmp [defaults to /tmp]

Usage

Running the script with no arguments will show the usage:

Usage: liftOverVCF.pl
    -vcf        <input vcf>
    -gatk       <path to gatk trunk>
    -chain      <chain file>
    -newRef     <path to new reference prefix; we will need newRef.dict, .fasta, and .fasta.fai>
    -oldRef     <path to old reference prefix; we will need oldRef.fasta>
    -out        <output vcf>
    -tmp            <temp file location; defaults to /tmp>
  • The 'tmp' argument is optional. It specifies the location to write the temporary file from step 1 of the process.


Chain files

Chain files from b36/hg18 to hg19 are located here within the Broad:

   /humgen/gsa-hpprojects/GATK/data/Liftover_Chain_Files/

External users can get them off our ftp site:

   location: ftp.broadinstitute.org
   username: gsapubftp-anonymous
   path:     Liftover_Chain_Files

Introduction

Three-stage procedure:

  • Create a master set of sites from your N batch VCFs that you want to genotype in all samples. At this stage you need to determine how you want to resolve disagreements among the VCFs. This is your master sites VCF.

  • Take the master sites VCF and genotype each sample BAM file at these sites

  • (Optionally) Merge the single sample VCFs into a master VCF file

Creating the master set of sites: SNPs and Indels

The first step of batch merging is to create a master set of sites that you want to genotype in all samples. To make this problem concrete, suppose I have two VCF files:

Batch 1:

##fileformat=VCFv4.0
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  NA12891 
20      9999996     .       A       ATC     .       PASS    .       GT:GQ   0/1:30
20      10000000        .       T       G       .       PASS    .       GT:GQ   0/1:30
20      10000117        .       C       T       .       FAIL    .       GT:GQ   0/1:30
20      10000211        .       C       T       .       PASS    .       GT:GQ   0/1:30
20      10001436        .       A       AGG     .       PASS    .       GT:GQ   1/1:30

Batch 2:

##fileformat=VCFv4.0
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  NA12878
20      9999996     .       A       ATC     .       PASS    .       GT:GQ   0/1:30
20      10000117        .       C       T       .       FAIL    .       GT:GQ   0/1:30
20      10000211        .       C       T       .       FAIL    .       GT:GQ   0/1:30
20      10000598        .       T       A       .       PASS    .       GT:GQ   1/1:30
20      10001436        .       A       AGGCT   .       PASS    .       GT:GQ   1/1:30

In order to merge these batches, I need to make a variety of bookkeeping and filtering decisions, as outlined in the merged VCF below:

Master VCF:

20      9999996     .       A       ATC     .       PASS    .       GT:GQ   0/1:30  [pass in both]
20      10000000        .       T       G       .       PASS    .       GT:GQ   0/1:30  [only in batch 1]
20      10000117        .       C       T       .       FAIL    .       GT:GQ   0/1:30  [fail in both]
20      10000211        .       C       T       .       FAIL    .       GT:GQ   0/1:30  [pass in 1, fail in 2, choice in unclear]
20      10000598        .       T       A       .       PASS    .       GT:GQ   1/1:30  [only in batch 2]
20      10001436        .       A       AGGCT   .       PASS    .       GT:GQ   1/1:30  [A/AGG in batch 1, A/AGGCT in batch 2, including this site may be problematic]

These issues fall into the following categories:

  • For sites present in all VCFs (20:9999996 above), the alleles agree, and each site PASS is pass, this site can obviously be considered "PASS" in the master VCF
  • Some sites may be PASS in one batch, but absent in others (20:10000000 and 20:10000598), which occurs when the site is polymorphic in one batch but all samples are reference or no-called in the other batch
  • Similarly, sites that are fail in all batches in which they occur can be safely filtered out, or included as failing filters in the master VCF (20:10000117)

There are two difficult situations that must be addressed by the needs of the project merging batches:

  • Some sites may be PASS in some batches but FAIL in others. This might indicate that either:
  • The site is actually truly polymorphic, but due to limited coverage, poor sequencing, or other issues it is flag as unreliable in some batches. In these cases, it makes sense to include the site
  • The site is actually a common machine artifact, but just happened to escape standard filtering in a few batches. In these cases, you would obviously like to filter out the site
  • Even more complicated, it is possible that in the PASS batches you have found a reliable allele (C/T, for example) while in others there's no alt allele but actually a low-frequency error, which is flagged as failing. Ideally, here you could filter out the failing allele from the FAIL batches, and keep the pass ones
  • Some sites may have multiple segregating alleles in each batch. Such sites are often errors, but in some cases may be actual multi-allelic sites, in particular for indels.

Unfortunately, we cannot determine which is actually the correct choice, especially given the goals of the project. We leave it up the project bioinformatician to handle these cases when creating the master VCF. We are hopeful that at some point in the future we'll have a consensus approach to handle such merging, but until then this will be a manual process.

The GATK tool CombineVariants can be used to merge multiple VCF files, and parameter choices will allow you to handle some of the above issues. With tools like SelectVariants one can slice-and-dice the merged VCFs to handle these complexities as appropriate for your project's needs. For example, the above master merge can be produced with the following CombineVariants:

java -jar dist/GenomeAnalysisTK.jar \
-T CombineVariants \
-R human_g1k_v37.fasta \
-V:one,VCF combine.1.vcf -V:two,VCF combine.2.vcf \
--sites_only \
-minimalVCF \
-o master.vcf

producing the following VCF:

##fileformat=VCFv4.0
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO
20      9999996     .       A       ACT         .       PASS    set=Intersection
20      10000000        .       T       G           .   PASS    set=one
20      10000117        .       C       T           .       FAIL    set=FilteredInAll
20      10000211        .       C       T           .       PASS    set=filterIntwo-one
20      10000598        .       T       A           .       PASS    set=two
20      10001436        .       A       AGG,AGGCT       .       PASS    set=Intersection

Genotyping your samples at these sites

Having created the master set of sites to genotype, along with their alleles, as in the previous section, you now use the UnifiedGenotyper to genotype each sample independently at the master set of sites. This GENOTYPE_GIVEN_ALLELES mode of the UnifiedGenotyper will jump into the sample BAM file, and calculate the genotype and genotype likelihoods of the sample at the site for each of the genotypes available for the REF and ALT alleles. For example, for site 10000211, the UnifiedGenotyper would evaluate the likelihoods of the CC, CT, and TT genotypes for the sample at this site, choose the most likely configuration, and generate a VCF record containing the genotype call and the likelihoods for the three genotype configurations.

As a concrete example command line, you can genotype the master.vcf file using in the bundle sample NA12878 with the following command:

java -Xmx2g -jar dist/GenomeAnalysisTK.jar \
-T UnifiedGenotyper \
-R bundle/b37/human_g1k_v37.fasta \
-I bundle/b37/NA12878.HiSeq.WGS.bwa.cleaned.recal.hg19.20.bam \
-alleles master.vcf \
-L master.vcf \
-gt_mode GENOTYPE_GIVEN_ALLELES \
-out_mode EMIT_ALL_SITES \
-stand_call_conf 0.0 \
-glm BOTH \
-G none \

The -L master.vcf argument tells the UG to only genotype the sites in the master file. If you don't specify this, the UG will genotype the master sites in GGA mode, but it will also genotype all other sites in the genome in regular mode.

The last item,-G ` prevents the UG from computing annotations you don't need. This command produces something like the following output:

##fileformat=VCFv4.0
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  NA12878
20      9999996     .       A       ACT         4576.19 .       .   GT:DP:GQ:PL     1/1:76:99:4576,229,0
20      10000000        .       T       G           0       .       .       GT:DP:GQ:PL     0/0:79:99:0,238,3093
20      10000211        .       C       T       857.79  .       .   GT:AD:DP:GQ:PL  0/1:28,27:55:99:888,0,870
20      10000598        .       T       A           1800.57 .       .   GT:AD:DP:GQ:PL  1/1:0,48:48:99:1834,144,0
20      10001436        .       A       AGG,AGGCT       1921.12 .       .   GT:DP:GQ:PL     0/2:49:84.06:1960,2065,0,2695,222,84

Several things should be noted here:

  • The genotype likelihoods calculation evolves, especially for indels, the exact results of this command will change.
  • The command will emit sites that are hom-ref in the sample at the site, but the -stand_call_conf 0.0 argument should be provided so that they aren't tagged as "LowQual" by the UnifiedGenotyper.
  • The filtered site 10000117 in the master.vcf is not genotyped by the UG, as it doesn't pass filters and so is considered bad by the GATK UG. If you want to determine the genotypes for all sites, independent on filtering, you must unfilter all of your records in master.vcf, and if desired, restore the filter string for these records later.

This genotyping command can be performed independently per sample, and so can be parallelized easily on a farm with one job per sample, as in the following:

foreach sample in samples:
  run UnifiedGenotyper command above with -I $sample.bam -o $sample.vcf
end

(Optional) Merging the sample VCFs together

You can use a similar command for CombineVariants above to merge back together all of your single sample genotyping runs. Suppose all of my UnifiedGenotyper jobs have completed, and I have VCF files named sample1.vcf, sample2.vcf, to sampleN.vcf. The single command:

java -jar dist/GenomeAnalysisTK.jar -T CombineVariants -R human_g1k_v37.fasta -V:sample1 sample1.vcf -V:sample2 sample2.vcf [repeat until] -V:sampleN sampleN.vcf -o combined.vcf

General notes

  • Because the GATK uses dynamic downsampling of reads, it is possible for truly marginal calls to change likelihoods from discovery (processing the BAM incrementally) vs. genotyping (jumping into the BAM). Consequently, do not be surprised to see minor differences in the genotypes for samples from discovery and genotyping.
  • More advanced users may want to consider group several samples together for genotyping. For example, 100 samples could be genotyped in 10 groups of 10 samples, resulting in only 10 VCF files. Merging the 10 VCF files may be faster (or just easier to manage) than 1000 individual VCFs.
  • Sometimes, using this method, a monomorphic site within a batch will be identified as polymorphic in one or more samples within that same batch. This is because the UnifiedGenotyper applies a frequency prior to determine whether a site is likely to be monomorphic. If the site is monomorphic, it is either not output, or if EMIT_ALL_SITES is thrown, reference genotypes are output. If the site is determined to be polymorphic, genotypes are assigned greedily (as of GATK-v1.4). Calling single-sample reduces the effect of the prior, so sites which were considered monomorphic within a batch could be considered polymorphic within a sub-batch.

Workflow

To call variants with the GATK using pedigree information, you should base your workflow on the Best Practices recommendations -- the principles detailed there all apply to pedigree analysis.

But there is one crucial addition: you should make sure to pass a pedigree file (PED file) to all GATK walkers that you use in your workflow. Some will deliver better results if they see the pedigree data.

At the moment there are two of the standard annotations affected by pedigree:

  • Allele Frequency (computed on founders only)
  • Inbreeding coefficient (computed on founders only)

Trio Analysis

In the specific case of trios, an additional GATK walker, PhaseByTransmission, should be used to obtain trio-aware genotypes as well as phase by descent.

Important note

The annotations mentioned above have been adapted for PED files starting with GATK v.1.6. If you already have VCF files generated by an older version of the GATK or have not passed a PED file while running the UnifiedGenotyper or VariantAnnotator, you should do the following:

  • Run the latest version of the VariantAnnotator to re-annotate your variants.
  • Re-annotate all the standard annotations by passing the argument -G StandardAnnotation to VariantAnnotator. Make sure you pass your PED file to the VariantAnnotator as well!
  • If you are using Variant Quality Score Recalibration (VQSR) with the InbreedingCoefficient as an annotation in your model, you should re-run VQSR once the InbreedingCoefficient is updated.

PED files

The PED files used as input for these tools are based on PLINK pedigree files. The general description can be found here.

For these tools, the PED files must contain only the first 6 columns from the PLINK format PED file, and no alleles, like a FAM file in PLINK.

Read-backed Phasing

Example and Command Line Arguments

For a complete, detailed argument reference, refer to the GATK document page here

Introduction

The biological unit of inheritance from each parent in a diploid organism is a set of single chromosomes, so that a diploid organism contains a set of pairs of corresponding chromosomes. The full sequence of each inherited chromosome is also known as a haplotype. It is critical to ascertain which variants are associated with one another in a particular individual. For example, if an individual's DNA possesses two consecutive heterozygous sites in a protein-coding sequence, there are two alternative scenarios of how these variants interact and affect the phenotype of the individual. In one scenario, they are on two different chromosomes, so each one has its own separate effect. On the other hand, if they co-occur on the same chromosome, they are thus expressed in the same protein molecule; moreover, if they are within the same codon, they are highly likely to encode an amino acid that is non-synonymous (relative to the other chromosome). The ReadBackedPhasing program serves to discover these haplotypes based on high-throughput sequencing reads.

The first step in phasing is to call variants ("genotype calling") using a SAM/BAM file of reads aligned to the reference genome -- this results in a VCF file. Using the VCF file and the SAM/BAM reads file, the ReadBackedPhasing tool considers all reads within a Bayesian framework and attempts to find the local haplotype with the highest probability, based on the reads observed.

The local haplotype and its phasing is encoded in the VCF file as a "|" symbol (which indicates that the alleles of the genotype correspond to the same order as the alleles for the genotype at the preceding variant site). For example, the following VCF indicates that SAMP1 is heterozygous at chromosome 20 positions 332341 and 332503, and the reference base at the first position (A) is on the same chromosome of SAMP1 as the alternate base at the latter position on that chromosome (G), and vice versa (G with C):

#CHROM  POS ID  REF ALT QUAL    FILTER  INFO    FORMAT  SAMP1   
chr20   332341  rs6076509   A   G   470.60  PASS    AB=0.46;AC=1;AF=0.50;AN=2;DB;DP=52;Dels=0.00;HRun=1;HaplotypeScore=0.98;MQ=59.11;MQ0=0;OQ=627.69;QD=12.07;SB=-145.57    GT:DP:GL:GQ 0/1:46:-79.92,-13.87,-84.22:99
chr20   332503  rs6133033   C   G   726.23  PASS    AB=0.57;AC=1;AF=0.50;AN=2;DB;DP=61;Dels=0.00;HRun=1;HaplotypeScore=0.95;MQ=60.00;MQ0=0;OQ=894.70;QD=14.67;SB=-472.75    GT:DP:GL:GQ:PQ  1|0:60:-110.83,-18.08,-149.73:99:126.93

The per-sample per-genotype PQ field is used to provide a Phred-scaled phasing quality score based on the statistical Bayesian framework employed for phasing. Note that for cases of homozygous sites that lie in between phased heterozygous sites, these homozygous sites will be phased with the same quality as the next heterozygous site.

Limitations:

  • ReadBackedPhasing doesn't currently support insertions, deletions, or multi-nucleotide polymorphisms.
  • Input VCF files should only be for diploid organisms.

More detailed aspects of semantics of phasing in the VCF format

  • The "|" symbol is used for each sample to indicate that each of the alleles of the genotype in question derive from the same haplotype as each of the alleles of the genotype of the same sample in the previous NON-FILTERED variant record. That is, rows without FILTER=PASS are essentially ignored in the read-backed phasing (RBP) algorithm.
  • Note that the first heterozygous genotype record in a pair of haplotypes will necessarily have a "/" - otherwise, they would be the continuation of the preceding haplotypes.
  • A homozygous genotype is always "appended" to the preceding haplotype. For example, any 0/0 or 1/1 record is always converted into 0|0 and 1|1.
  • RBP attempts to phase a heterozygous genotype relative the preceding HETEROZYGOUS genotype for that sample. If there is sufficient read information to deduce the two haplotypes (for that sample), then the current genotype is declared phased ("/" changed to "|") and assigned a PQ that is proportional to the estimated Phred-scaled error rate. All homozygous genotypes for that sample that lie in between the two heterozygous genotypes are also assigned the same PQ value (and remain phased).
  • If RBP cannot phase the heterozygous genotype, then the genotype remains with a "/", and no PQ score is assigned. This site essentially starts a new section of haplotype for this sample.

For example, consider the following records from the VCF file:

#CHROM  POS ID  REF ALT QUAL    FILTER  INFO    FORMAT  SAMP1   SAMP2
chr1    1   .   A   G   99  PASS    .   GT:GL:GQ    0/1:-100,0,-100:99  0/1:-100,0,-100:99
chr1    2   .   A   G   99  PASS    .   GT:GL:GQ:PQ 1|1:-100,0,-100:99:60   0|1:-100,0,-100:99:50
chr1    3   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:60   0|0:-100,0,-100:99:60
chr1    4   .   A   G   99  FAIL    .   GT:GL:GQ    0/1:-100,0,-100:99  0/1:-100,0,-100:99
chr1    5   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:70   1|0:-100,0,-100:99:60
chr1    6   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0/1:-100,0,-100:99  1|1:-100,0,-100:99:70
chr1    7   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:80   0|1:-100,0,-100:99:70
chr1    8   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:90   0|1:-100,0,-100:99:80

The proper interpretation of these records is that SAMP1 has the following haplotypes at positions 1-5 of chromosome 1:

  1. AGAAA
  2. GGGAG

And two haplotypes at positions 6-8:

  1. AAA
  2. GGG

And, SAMP2 has the two haplotypes at positions 1-8:

  1. AAAAGGAA
  2. GGAAAGGG
  • Note that we have excluded the non-PASS SNP call (at chr1:4), thus assuming that both samples are homozygous reference at that site.

Slides that explain the VQSR methodology as well as the individual component variant annotations can be found here in the GSA Public Drop Box.

Detailed information about command line options for VariantRecalibrator can be found here.

Detailed information about command line options for ApplyRecalibration can be found here.

Introduction

The purpose of the variant recalibrator is to assign a well-calibrated probability to each variant call in a call set. One can then create highly accurate call sets by filtering based on this single estimate for the accuracy of each call.

The approach taken by variant quality score recalibration is to develop a continuous, covarying estimate of the relationship between SNP call annotations (QD, SB, HaplotypeScore, HRun, for example) and the the probability that a SNP is a true genetic variant versus a sequencing or data processing artifact. This model is determined adaptively based on "true sites" provided as input, typically HapMap 3 sites and those sites found to be polymorphic on the Omni 2.5M SNP chip array. This adaptive error model can then be applied to both known and novel variation discovered in the call set of interest to evaluate the probability that each call is real. The score that gets added to the INFO field of each variant is called the VQSLOD. It is the log odds ratio of being a true variant versus being false under the trained Gaussian mixture model. The variant recalibrator contrastively evaluates variants in a two step process:

  • VariantRecalibration - Create a Gaussian mixture model by looking at the annotations values over a high quality subset of the input call set and then evaluate all input variants.
  • ApplyRecalibration - Apply the model parameters to each variant in input VCF files producing a recalibrated VCF file in which each variant is annotated with its VQSLOD value. In addition, this step will filter the calls based on this new lod score by adding lines to the FILTER column for variants that don't meet the lod threshold as provided by the user (with the ts_filter_level parameter).

Recalibration tutorial with example HiSeq, single sample, deep coverage, whole genome call set

By way of explaining how one uses the variant quality score recalibrator and evaluating its performance we have put together this tutorial which uses example sequencing data produced at the Broad Institute. All of the data used in this tutorial is available in VCF format from our GATK resource bundle.

Input call set

input: NA12878.HiSeq.WGS.bwa.cleaned.raw.b37.subset.vcf

  • These calls were generated with the UnifiedGenotyper from a 30X coverage modern, single sample run of HiSeq. They were randomly downsampled to keep the file size small but in general one would want to use the full set of variants available genome-wide for this procedure. No other pre-filtering steps were applied to the raw output.

Training sets

HapMap 3.3: hapmap_3.3.b37.sites.vcf

  • These high quality sites are used both to train the Gaussian mixture model and then again when choosing a LOD threshold based on sensitivity to truth sites.
  • The parameters for these sites will be: known = false, training = true, truth = true, prior = Q15 (96.84%)

Omni 2.5M chip: 1000G_omni2.5.b37.sites.vcf

  • These polymorphic sites from the Omni genotyping array are used when training the model.
  • The parameters for these sites will be: known = false, training = true, truth = false, prior = Q12 (93.69%)

dbSNP build 132: dbsnp_132.b37.vcf

  • The dbsnp sites are generally considered to be not of high enough quality to be used in training but here we stratify output metrics such as ti/tv ratio by presence in dbsnp (known sites) or not (novel sites).
  • The parameters for these sites will be: known = true, training = false, truth = false, prior = Q8 (84.15%)

The default prior for all other variants is Q2 (36.90%). This low value reflects the fact that the philosophy of the UnifiedGenotyper is to produce a large, highly sensitive callset that needs to be heavily refined through additional filtering.

VariantRecalibrator

Detailed information about command line options for VariantRecalibrator can be found here.

Build a Gaussian mixture model using a high quality subset of the input variants and evaluate those model parameters over the full call set. The following notes describe the appropriate inputs to use for this tool.

  • Note that this walker expects call sets in which each record has been appropriately annotated (see e.g. VariantAnnotator). Input call set rod bindings must start with "input". See the command line below.
  • When constructing an initial call set (see e.g. Unified Genotyper or Haplotype Caller) for use with the Recalibrator, it's generally best to turn down the confidence threshold to allow more borderline calls (trusting the Recalibrator to keep the real ones while filtering out the false positives). For example, we often use a Q20 threshold on our deep coverage calls with the Recalibrator (whereas the default threshold in the UnifiedGenotyper is Q30).
  • No pre-filtering is necessary when using the Recalibrator. See below for the advanced options which allow the user to selectively ignore certain filters if they have already been applied to your call set.
  • The tool accepts any ROD bindings when specifying the set of truth sites to be used during modeling. Information about how to download VCF files which we routinely use for training is in the FAQ section at the bottom of the page.
  • Each training set ROD binding is specified with key-value tags to qualify whether the set should be considered as known sites, training sites, and/or truth sites. Additionally, the prior probability of being true for those sites is also specified via these tags in Phred scale. See the command line below for an example. An explanation for how each of the training sets is used by the algorithm:
  • Training sites: Input variants which are found to overlap with these training sites are used to build the Gaussian mixture model.
  • Truth sites: When deciding where to set the cutoff in VQSLOD sensitivity to these truth sites is used. Typically one might want to say I dropped my threshold until I got back 99% of HapMap sites, for example.
  • Known sites: The known / novel status of a variant isn't used by the algorithm itself and is only used for reporting / display purposes. The output metrics are stratified by known status in order to aid in comparisons with other call sets.

Interpretation of the Gaussian mixture model plots

The variant recalibration step fits a Gaussian mixture model to the contextual annotations given to each variant. By fitting this probability model to the training variants (variants considered to be true-positives), a probability can be assigned to the putative novel variants (some of which will be true-positives, some of which will be false-positives). It is useful for users to see how the probability model was fit to their data. Therefore a modeling report is automatically generated each time VariantRecalibrator is run (in the above command line the report will appear as path/to/output.plots.R.pdf). For every pair-wise combination of annotations used in modeling, a 2D projection of the Gaussian mixture model is shown.

Gaussian mixture model report that is automatically generated by the VQSR from the example HiSeq call set. This page shows the 2D projection of mapping quality rank sum test versus Haplotype score by marginalizing over the other annotation dimensions in the model.

In each page there are four panels which show different ways of looking at the 2D projection of the model. The upper left panel shows the probability density function that was fit to the data. The 2D projection was created by marginalizing over the other annotation dimensions in the model via random sampling. Green areas show locations in the space that are indicative of being high quality while red areas show the lowest probability areas. In general putative SNPs that fall in the red regions will be filtered out of the recalibrated call set.

The remaining three panels give scatter plots in which each SNP is plotted in the two annotation dimensions as points in a point cloud. The scale for each dimension is in normalized units. The data for the three panels is the same but the points are colored in different ways to highlight different aspects of the data. In the upper right panel SNPs are colored black and red to show which SNPs are retained and filtered, respectively, by applying the VQSR procedure. The red SNPs didn't meet the given truth sensitivity threshold and so are filtered out of the call set. The lower left panel colors SNPs green, grey, and purple to give a sense of the distribution of the variants used to train the model. The green SNPs are those which were found in the training sets passed into the VariantRecalibrator step, while the purple SNPs are those which were found to be furthest away from the learned Gaussians and thus given the lowest probability of being true. Finally, the lower right panel colors each SNP by their known/novel status with blue being the known SNPs and red being the novel SNPs. Here the idea is to see if the annotation dimensions provide a clear separation between the known SNPs (most of which are true) and the novel SNPs (most of which are false).

An example of good clustering for SNP calls from the tutorial dataset is shown to the right. The plot shows that the training data forms a distinct cluster at low values for each of the two statistics shown (haplotype score and mapping quality bias). As the SNPs fall off the distribution in either one or both of the dimensions they are assigned a lower probability (that is, move into the red region of the model's PDF) and are filtered out. This makes sense as not only do higher values of HaplotypeScore indicate a lower chance of the data being explained by only two haplotypes but also higher values for mapping quality bias indicate more evidence of bias between the reference bases and the alternative bases. The model has captured our intuition that this area of the distribution is highly enriched for machine artifacts and putative variants here should be filtered out!

Tranches and the tranche plot

The recalibrated variant quality score provides a continuous estimate of the probability that each variant is true, allowing one to partition the call sets into quality tranches. The first tranche is exceedingly specific but less sensitive, and each subsequent tranche in turn introduces additional true positive calls along with a growing number of false positive calls. Downstream applications can select in a principled way more specific or more sensitive call sets or incorporate directly the recalibrated quality scores to avoid entirely the need to analyze only a fixed subset of calls but rather weight individual variant calls by their probability of being real. An example tranche plot, automatically generated by the VariantRecalibator walker, is shown on the right.

Tranches plot for example HiSeq call set. The x-axis gives the number of novel variants called while the y-axis shows two quality metrics -- novel transition to transversion ratio and the overall truth sensitivity.

Ti/Tv-free recalibration

We use a Ti/Tv-free approach to variant quality score recalibration. This approach requires an additional truth data set, and cuts the VQSLOD at given sensitivities to the truth set. It has several advantages over the Ti/Tv-targeted approach:

  • The truth sensitivity (TS) approach gives you back the novel Ti/Tv as a QC metric [YES!]
  • The truth sensitivity (TS) approach is conceptual cleaner than deciding on a novel Ti/Tv target for your dataset
  • The TS approach is easier to explain and defend, as saying "I took called variants until I found 99% of my known variable sites" is easier than "I took variants until I dropped my novel Ti/Tv ratio to 2.07"

We have used hapmap 3.3 sites as the truth set (genotypes_r27_nr.b37_fwd.vcf), but other sets of high-quality (~99% truly variable in the population) sets of sites should work just as well. In our experience, with HapMap, 99% is a good threshold, as the remaining 1% of sites often exhibit unusual features like being close to indels or are actually MNPs, and so receive a low VQSLOD score.
Note that the expected Ti/Tv is still an available argument but it is only used for display purposes.

ApplyRecalibration

Detailed information about command line options for ApplyRecalibration can be found here.

Using the tranche file generated by the previous step the ApplyRecalibration walker looks at each variant's VQSLOD value and decides which tranche it falls in. Variants in tranches that fall below the specified truth sensitivity filter level have their filter field annotated with its tranche level. This will result in a call set that simultaneously is filtered to the desired level but also has the information necessary to pull out more variants at a slightly lower quality level.

Frequently Asked Questions

How do I know which annotations to use for my data?

The five annotation values provided in the command lines above (QD, HaplotypeScore, MQRankSum, ReadPosRankSum, and HRun) have been show to give good results for a variety of data types. However this shouldn't be taken to mean these annotations give the absolute best modeling for every source of sequencing data. Better results could possibly be achieved through experimentation with which SNP annotations are used in the algorithm. The goal is to find annotation values with are approximately Gaussianly distributed and also serve to separate the probably true (known) SNPs from the probably false (novel) SNPs.

How do I know which -tranche arguments to pass into the VariantRecalibrator step?

The -tranche arguments main purpose is to create the tranche plot (as shown above). They are meant to convey the idea that with real, calibrated variant quality scores one can create call sets in which each variant doesn't have to have a hard answer as to whether it is in or out of the set. If a very high accuracy call set is desired then one can use the highest tranche, but if a larger, more complete call set is a higher priority than one can dip down into lower and lower tranches. These tranches are applied to the output VCF file using the FILTER field. In this way an end user can choose to use some of the filtered records or only use the PASSing records. For new users to the variant quality score recalibrator perhaps the easiest thing to do in the beginning is simply select the single desired false discovery rate and pass that value in as a single -tranche argument to make sure that the desired rate can be achieved given the other parameters to the algorithm.

What should I use as training data?

The VariantRecalibrator step accept lists of truth and training sites in several formats (dbsnp ROD, VCF, and BED, for example). Any list can be used but it is best to use only those sets which are of the best quality. The truth sets are passed into the algorithm using any rod binding name and their truth or training status is specified with rod tags (see VariantRecalibrator section above). We routinely use the HapMap v3.3 VCF file and the Omni2.5M SNP chip array in training the model. In general the false positive rate of dbsnp sites is too high to be used reliably for training the model.

HapMap v3.3 as well as the Omni validation array VCF files are available in our GATK resource bundle.

Does the VQSR work with non-human variant calls?

Absolutely! The VQSR accepts any list of sites to use as training / truth data, not just HapMap.

Don't have any truth data for your organism? No problem. There are several things one might experiment with. One idea is to first do an initial round of SNP calling and only use those SNPs which have the highest quality scores. These sites which have the most confidence are probably real and could be used as truth data to help disambiguate the rest of the variants in the call set. Another idea is to try using several SNP caller, of which the GATK is one, and use those sites which are concordant between the different methods as truth data. There are many fruitful avenues of research here. Hopefully the model reporting plots help facilitate this experimentation. Perhaps the best place to begin is to use a line like the following when specifying the truth set:

-resource:concordantSet,known=true,training=true,truth=true,prior=10.0 path/to/concordantSet.vcf

Can I use the variant quality score recalibrator with my small sequencing experiment?

This tool is expecting thousands of variant sites in order to achieve decent modeling with the Gaussian mixture model. Whole exome call sets work well, but anything smaller than that scale might run into difficulties. One piece of advice is to turn down the number of Gaussians used during training and to turn up the number of variants that are used to train the negative model. This can be accomplished by adding --maxGaussians 4 --percentBad 0.05 to your command line.

percentBadVariants is the proportion of variants that the program will use to build the negative model. If you have a small callset, you need to use a larger proportion in order to have enough "bad" variants to build the negative model. maxGaussians is the maximum number of different "clusters" (=Gaussians) of variants the program is "allowed" to try to identify. Lowering this number forces the program to group variants into a smaller number of clusters, which means there will be more variants in each cluster -- hopefully enough to satisfy the statistical requirements. Of course, this decreases the level of discrimination that you can achieve between variant profiles/error modes. It's all about trade-offs; and unfortunately if you don't have a lot of variants you can't afford to be very demanding in terms of resolution.

Why don't all the plots get generated for me?

The most common problem related to this is not having Rscript accessible in your environment path. Rscript is the command line version of R that gets installed right alongside. We also make use of the ggplot2 library so please be sure to install that package as well.

Sorry, there are no publicly available documents of this type with the tag #methods. Try one of the other types.
Sorry, there are no publicly available documents of this type with the tag #methods. Try one of the other types.