Tagged with #malformedbam
0 documentation articles | 0 announcements | 2 forum discussions


No posts found with the requested search criteria.
No posts found with the requested search criteria.
Comments (3)

Hallo,

I running a pipline for exome data. I have 7 exome samples. When the pipeline arrive at the UnifiedGenotyper i always get the error my bam files are malformed.

MESSAGE: SAM/BAM file /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261951.recal.bam is malformed: BGZF file has invalid uncompressedLength: -1792842732

All the bam files have are serveral GB big. So I do not get i why the uncompressed length is negative. Here is what is executed:

java -Xmx8g -jar /lib/gatk/GenomeAnalysisTK-2.1-13-g1706365/GenomeAnalysisTK.jar -T UnifiedGenotyper -R /tmp/db99fcb54f49eea7ce46ff16a802f7ac/human_g1k_v37.fasta -nt 30 -glm BOTH -A AlleleBalance -A DepthOfCoverage -A FisherStrand -D /tmp/db99fcb54f49eea7ce46ff16a802f7ac/dbsnp_135.b37.vcf -o samples.variants.raw.vcf -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261951.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261953.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261952.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261954.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261950.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261955.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261956.recal.bam

Thanks,

Robin

Comments (5)

Hi,

I run into an error at step of IndelRealigner for GATK v2.0 complaining about SAM/BAM file has inconsistent mapping information

here is the command I used (take out full path for clarity):

java -Xmx4g -jar /Path/GenomeAnalysisTK-2.1-8-g5efb575/bin/GenomeAnalysisTK.jar -T IndelRealigner -I /Path/myBam.bam -R /path/hg19.fa -targetIntervals /path/myBam.output.intervals -o /Path/my_realignedBam.bam -known /Path/bundle-1.5/hg19/Mills_and_1000G_ gold_standard.indels.hg19.sites.vcf -known /Path/bundle-1.5/hg19/1000G_phase1.indels.hg19.vcf

Here is the error message I encountered: ...

ERROR MESSAGE: SAM/BAM file SAMFileReader{/Path/myBam.bam} is malformed: read NCI-GA1:30:70BETAAXX:2:114

:10000:10163 145 chr1 * 37 108M chr14 59648529 * GCAAGACCAACAAGAAGATCGCCATTGCTAACTGTGGACAACTCTAATAAATTTGGCTTGTGTTTTATCTTAGCCACCACACTGTTCTTTCTG TAGCTCAAGAGAGTA @?BEC@BCB@DB@;=8BAB<8BDDDEFIIHEIHI>I<IIDHHIHDIIII@GIDIIIIICIIHIHIHIIIIIIBIIHIIDIHIIIIIIFIDI has inconsistent mapping information.

ERROR ------------------------------------------------------------------------------------------

...

Anybody encountered similar issue? Advice would be greatly appreciated!

Mike