We support three types of interval lists, as mentioned here. Interval lists should preferentially be formatted as Picard-style interval lists, with an explicit sequence dictionary, as this prevents accidental misuse (e.g. hg18 intervals on an hg19 file). Note that this file is 1-based, not 0-based (first position in the genome is position 1).
One relatively easy way to combine your intervals is to use the online tool Galaxy, using the Get Data -> Upload command to upload your intervals, and the Operate on Genomic Intervals command to compute the intersection or union of your intervals (depending on your needs).
The GATK requires the reference sequence in a single reference sequence in FASTA format, with all contigs in the same file. The GATK requires strict adherence to the FASTA standard. Only the standard ACGT bases are accepted; no non-standard bases (W, for example) are tolerated. Gzipped fasta files will not work with the GATK, so please make sure to unzip them first. Please see this article for more information on preparing FASTA reference sequences for use with the GATK.
If you are using human data, your reads must be aligned to one of the official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The contig ordering in the reference you used must exactly match that of one of the official references canonical orderings. These are defined by historical karotyping of largest to smallest chromosomes, followed by the X, Y, and MT for the b3x references; the order is thus 1, 2, 3, ..., 10, 11, 12, ... 20, 21, 22, X, Y, MT. The hg1x references differ in that the chromosome names are prefixed with "chr" and chrM appears first instead of last. The GATK will detect misordered contigs (for example, lexicographically sorted) and throw an error. This draconian approach, though unnecessary technically, ensures that all supplementary data provided with the GATK works correctly. You can use ReorderSam to fix a BAM file aligned to a missorted reference sequence.
Our Best Practice recommendation is that you use a standard GATK reference from the GATK resource bundle.
The only input format for NGS reads that the GATK supports is the [Sequence Alignment/Map (SAM)] format. See [SAM/BAM] for more details on the SAM/BAM format as well as Samtools and Picard, two complementary sets of utilities for working with SAM/BAM files.
In addition to being in SAM format, we require the following additional constraints in order to use your file with the GATK:
.bam file extension).Below is an example well-formed SAM field header and fields from the 1000 Genomes Project:
@HD VN:1.0 GO:none SO:coordinate
@SQ SN:1 LN:249250621 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:1b22b98cdeb4a9304cb5d48026a85128
@SQ SN:2 LN:243199373 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:a0d9851da00400dec1098a9255ac712e
@SQ SN:3 LN:198022430 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:fdfd811849cc2fadebc929bb925902e5
@SQ SN:4 LN:191154276 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:23dccd106897542ad87d2765d28a19a1
@SQ SN:5 LN:180915260 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:0740173db9ffd264d728f32784845cd7
@SQ SN:6 LN:171115067 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:1d3a93a248d92a729ee764823acbbc6b
@SQ SN:7 LN:159138663 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:618366e953d6aaad97dbe4777c29375e
@SQ SN:8 LN:146364022 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:96f514a9929e410c6651697bded59aec
@SQ SN:9 LN:141213431 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:3e273117f15e0a400f01055d9f393768
@SQ SN:10 LN:135534747 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:988c28e000e84c26d552359af1ea2e1d
@SQ SN:11 LN:135006516 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:98c59049a2df285c76ffb1c6db8f8b96
@SQ SN:12 LN:133851895 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:51851ac0e1a115847ad36449b0015864
@SQ SN:13 LN:115169878 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:283f8d7892baa81b510a015719ca7b0b
@SQ SN:14 LN:107349540 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:98f3cae32b2a2e9524bc19813927542e
@SQ SN:15 LN:102531392 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:e5645a794a8238215b2cd77acb95a078
@SQ SN:16 LN:90354753 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:fc9b1a7b42b97a864f56b348b06095e6
@SQ SN:17 LN:81195210 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:351f64d4f4f9ddd45b35336ad97aa6de
@SQ SN:18 LN:78077248 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c
@SQ SN:19 LN:59128983 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:1aacd71f30db8e561810913e0b72636d
@SQ SN:20 LN:63025520 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:0dec9660ec1efaaf33281c0d5ea2560f
@SQ SN:21 LN:48129895 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:2979a6085bfe28e3ad6f552f361ed74d
@SQ SN:22 LN:51304566 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:a718acaa6135fdca8357d5bfe94211dd
@SQ SN:X LN:155270560 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:7e0e2e580297b7764e31dbc80c2540dd
@SQ SN:Y LN:59373566 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:1fa3474750af0948bdf97d5a0ee52e51
@SQ SN:MT LN:16569 AS:NCBI37 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:c68f52674c9fb33aef52dcf399755519
@RG ID:ERR000162 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR000252 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR001684 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR001685 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR001686 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR001687 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR001688 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR001689 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR001690 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002307 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002308 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002309 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002310 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002311 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002312 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002313 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@RG ID:ERR002434 PL:ILLUMINA LB:g1k-sc-NA12776-CEU-1 PI:200 DS:SRP000031 SM:NA12776 CN:SC
@PG ID:GATK TableRecalibration VN:v2.2.16 CL:Covariates=[ReadGroupCovariate, QualityScoreCovariate, DinucCovariate, CycleCovariate], use_original_quals=true, defau
t_read_group=DefaultReadGroup, default_platform=Illumina, force_read_group=null, force_platform=null, solid_recal_mode=SET_Q_ZERO, window_size_nqs=5, homopolymer_nback=7, except on_if_no_tile=false, pQ=5, maxQ=40, smoothing=137 UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta M5:b4eb71ee878d3706246b7c1dbef69299
@PG ID:bwa VN:0.5.5
ERR001685.4315085 16 1 9997 25 35M * 0 0 CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT ?8:C7ACAABBCBAAB?CCAABBEBA@ACEBBB@? XT:A:U XN:i:4 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 RG:Z:ERR001685 NM:i:6 MD:Z:0N0N0N0N1A0A28 OQ:Z:>>:>2>>>>>>>>>>>>>>>>>>?>>>>??>???>
ERR001689.1165834 117 1 9997 0 * = 9997 0 CCGATCTAGGGTTAGGGTTAGGGTTAGGGTTAGGG >7AA<@@C?@?B?B??>9?B??>A?B???BAB??@ RG:Z:ERR001689 OQ:Z:>:<<8<<<><<><><<>7<>>>?>>??>???????
ERR001689.1165834 185 1 9997 25 35M = 9997 0 CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT 758A:?>>8?=@@>>?;4<>=??@@==??@?==?8 XT:A:U XN:i:4 SM:i:25 AM:i:0 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 RG:Z:ERR001689 NM:i:6 MD:Z:0N0N0N0N1A0A28 OQ:Z:;74>7><><><>>>>><:<>>>>>>>>>>>>>>>>
ERR001688.2681347 117 1 9998 0 * = 9998 0 CGATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 5@BA@A6B???A?B??>B@B??>B@B??>BAB??? RG:Z:ERR001688 OQ:Z:=>>>><4><<?><??????????????????????
The GATK requires that the BAM file be sorted in the same order as the reference. Unfortunately, many BAM files have headers that are sorted in some other order -- lexicographical order is a common alternative. To resort the BAM file please use ReorderSam.
The GATK accept interval files for processing subsets of the genome in Picard-style interval lists. These files have a .interval_list extension and look like this:
@HD VN:1.0 SO:coordinate
@SQ SN:1 LN:249250621 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:1b22b98cdeb4a9304cb5d48026a85128 SP:Homo Sapiens
@SQ SN:2 LN:243199373 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:a0d9851da00400dec1098a9255ac712e SP:Homo Sapiens
@SQ SN:3 LN:198022430 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:fdfd811849cc2fadebc929bb925902e5 SP:Homo Sapiens
@SQ SN:4 LN:191154276 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:23dccd106897542ad87d2765d28a19a1 SP:Homo Sapiens
@SQ SN:5 LN:180915260 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:0740173db9ffd264d728f32784845cd7 SP:Homo Sapiens
@SQ SN:6 LN:171115067 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:1d3a93a248d92a729ee764823acbbc6b SP:Homo Sapiens
@SQ SN:7 LN:159138663 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:618366e953d6aaad97dbe4777c29375e SP:Homo Sapiens
@SQ SN:8 LN:146364022 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:96f514a9929e410c6651697bded59aec SP:Homo Sapiens
@SQ SN:9 LN:141213431 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:3e273117f15e0a400f01055d9f393768 SP:Homo Sapiens
@SQ SN:10 LN:135534747 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:988c28e000e84c26d552359af1ea2e1d SP:Homo Sapiens
@SQ SN:11 LN:135006516 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:98c59049a2df285c76ffb1c6db8f8b96 SP:Homo Sapiens
@SQ SN:12 LN:133851895 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:51851ac0e1a115847ad36449b0015864 SP:Homo Sapiens
@SQ SN:13 LN:115169878 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:283f8d7892baa81b510a015719ca7b0b SP:Homo Sapiens
@SQ SN:14 LN:107349540 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:98f3cae32b2a2e9524bc19813927542e SP:Homo Sapiens
@SQ SN:15 LN:102531392 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:e5645a794a8238215b2cd77acb95a078 SP:Homo Sapiens
@SQ SN:16 LN:90354753 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:fc9b1a7b42b97a864f56b348b06095e6 SP:Homo Sapiens
@SQ SN:17 LN:81195210 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:351f64d4f4f9ddd45b35336ad97aa6de SP:Homo Sapiens
@SQ SN:18 LN:78077248 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c SP:Homo Sapiens
@SQ SN:19 LN:59128983 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:1aacd71f30db8e561810913e0b72636d SP:Homo Sapiens
@SQ SN:20 LN:63025520 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:0dec9660ec1efaaf33281c0d5ea2560f SP:Homo Sapiens
@SQ SN:21 LN:48129895 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:2979a6085bfe28e3ad6f552f361ed74d SP:Homo Sapiens
@SQ SN:22 LN:51304566 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:a718acaa6135fdca8357d5bfe94211dd SP:Homo Sapiens
@SQ SN:X LN:155270560 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:7e0e2e580297b7764e31dbc80c2540dd SP:Homo Sapiens
@SQ SN:Y LN:59373566 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:1fa3474750af0948bdf97d5a0ee52e51 SP:Homo Sapiens
@SQ SN:MT LN:16569 AS:GRCh37 UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta M5:c68f52674c9fb33aef52dcf399755519 SP:Homo Sapiens
1 30366 30503 + target_1
1 69089 70010 + target_2
1 367657 368599 + target_3
1 621094 622036 + target_4
1 861320 861395 + target_5
1 865533 865718 + target_6
...
consisting of a SAM-file-like sequence dictionary (the header), and targets in the form of .dict extension) and your intervals into one file.
You can also specify a list of intervals in a .interval_list file formatted as
Finally, we also accept BED style interval lists. Warning: this file format is 0-based for the start coordinates, so coordinates taken from 1-based formats should be offset by 1.
The GATK can associate arbitrary reference ordered data (ROD) files with named tracks for all tools. Some tools require specific ROD data files for processing, and developers are free to write tools that access arbitrary data sets using the ROD interface. The general ROD system has the following syntax:
-argumentName:name,type file
Where name is the name in the GATK tool (like "eval" in VariantEval), type is the type of the file, such as VCF or dbSNP, and file is the path to the file containing the ROD data.
The GATK supports several common file formats for reading ROD data:
Note that we no longer support the PED format. See here for converting .ped files to VCF.
Hello, I want to know how important it is to have the -L target-intervals.intervals option in UnifiedGenotyper, and if it is recommended in VariantCallRecalibrator too.
I have ran the Unified Genotyper tool with 1 input file at a time or the 2 files I want to compare at once. My command-lines are the following:
java -jar -Xmx15g GenomeAnalysisTK.jar -R ./genome.fa -T UnifiedGenotyper -I ./1.bam --dbsnp ./dbsnp_137.hg19.vcf -o ./1-gatk.vcf --min_base_quality_score 25 -stand_call_conf 50 -stand_emit_conf 10 -dcov 200 -L ./intervals-1.intervals
java -jar -Xmx15g GenomeAnalysisTK.jar -R ./genome.fa -T UnifiedGenotyper -I ./2.bam --dbsnp ./dbsnp_137.hg19.vcf -o ./2-gatk.vcf --min_base_quality_score 25 -stand_call_conf 50 -stand_emit_conf 10 -dcov 200 -L ./intervals-2.intervals
java -jar -Xmx15g GenomeAnalysisTK.jar -R ./genome.fa -T UnifiedGenotyper -I ./1.bam -I ./2.bam --dbsnp ./dbsnp_137.hg19.vcf -o ./1vs2-gatk.vcf --min_base_quality_score 25 -stand_call_conf 50 -stand_emit_conf 10 -dcov 200 -L ./intervals-1.intervals -L ./intervals-2.intervals
Thanks, G.
I got this error message, when trying to use a file to specify at which positions to emit variants:
ERROR MESSAGE: Couldn't read file /lustre/scratch109/sanger/tc9/agv/wgs/pipeline/union4x.positions because The interval file /lustre/scratch109/sanger/tc9/agv/wgs/pipeline/union4x.positions does not have one of the supported extensions (.bed, .list, .picard, .interval_list, or .intervals). Please rename your file with the appropriate extension. Is there a GATK page describing those 5 file formats? Some of them are unknown to me; e.g. .list.
I asked my question here, but please ignore it: http://gatkforums.broadinstitute.org/discussion/2219/l-option
Thanks a lot.
Also, the error message does not mention support for vcf files, but the documentation does. Are vcf files supported?
Hi there,
this is my interval_list
chr1 762095 762275 LINC00115|NR_024321 chr1 762280 762414 LINC00115|NR_024321 chr1 762420 762565 LINC00115|NR_024321 chr1 777259 777349 LOC643837 chr1 777391 777481 LOC643837 chr1 777482 777642 LOC643837 chr1 783061 783151 LOC643837 chr1 792270 792446 LOC643837 chr1 861266 861496 NM_152486|SAMD11 chr1 865582 865787 NM_152486|SAMD11 chr1 866331 866507 NM_152486|SAMD11
and this is the output from the sample_interval_summary
chr1:762095-762275 ... chr1:762280-762414 ... chr1:762420-762565 ... chr1:777259-777349 ... chr1:783061-783151 ... chr1:792270-792446 ... chr1:861266-861496 ... chr1:865582-865787 ... chr1:866331-866507 ...
why am I missing two exons?
this is my cmd:
java -Xmx32g -jar /local/apps/gatk/2.5-2-gf57256b/GenomeAnalysisTK.jar -I sample.bam -R .../genome.fa -T DepthOfCoverage -o jtn -geneList hg19.tsv -L exons.list --omitDepthOutputAtEachBase --includeDeletions --interval_merging OVERLAPPING_ONLY -l INFO
Thanks for your input!
/M
Hi, I am using FastaAlternateReferenceMaker and have a set of intervals ordered first by chromosome and then by their start positions. I have tried ordering chromosomes alphabetically(chr1, chr10, chr11,..) as well as numerically (chr1, chr2, chr3...) but the output fasta sequence returned is not in the same order as listed in interval file. I find that even the names target_1, target_2 etc are also not used as fasta headers in the output file. I am stuck with mapping the input intervals with the output fasta sequences. Thanks in advance for all the help, Ramya
GATK Queue implements a Scatter/Gather algorithm to create a set of intervals in order to parallelise data alalysis. If -scatter_gather option is issued, a respective number of interval files will be created and the input BAM files will be processed using these intervals. However a question arises what happens if the point of subsequent analysis is at or near the start/end of an interval? Are all the codes which support -l/-L options robust in the respect to interval positions? Since the input files are not actually spliced, all information is available to the processing program which could make the right decisions so that no artefacts are produced. Are there any restrictions on interval creation? Perhaps it should be at least a few read lengths. Anything else? Thanks in advance!
Hello,
I am using one of the 1000 Genomes exome data (*.bam format) which is called NA12892, aligned to the GRCh37 build. And I just started to use IndelRealigner tool which requires proper *.interval_list file to work.
However, I am unable to find/generate *.interval_list file compatible with my data. Where can I download/generate *.interval_list (or *.bed) file that are compatible with exome data?
Normally, these files are provided by producers for Library Prep. kits (e.g illumina). But, I couldn't find which interval file should be used in 1000 Genomes data.
Thank you.