Tagged with #inputs
4 documentation articles | 0 events or announcements | 0 forum discussions


The GATK uses two files to access and safety check access to the reference files: a .dict dictionary of the contig names and sizes and a .fai fasta index file to allow efficient random access to the reference bases. You have to generate these files in order to be able to use a Fasta file as reference.

NOTE: Picard and samtools treat spaces in contig names differently. We recommend that you avoid using spaces in contig names.

Creating the fasta sequence dictionary file

We use CreateSequenceDictionary.jar from Picard to create a .dict file from a fasta file.

> java -jar CreateSequenceDictionary.jar R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:11 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:58 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary done.
Runtime.totalMemory()=2112487424
44.922u 2.308s 0:47.09 100.2%   0+0k 0+0io 2pf+0w

This produces a SAM-style header file describing the contents of our fasta file.

> cat Homo_sapiens_assembly18.dict 
@HD     VN:1.0  SO:unsorted
@SQ     SN:chrM LN:16571        UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d2ed829b8a1628d16cbeee88e88e39eb
@SQ     SN:chr1 LN:247249719    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9ebc6df9496613f373e73396d5b3b6b6
@SQ     SN:chr2 LN:242951149    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:b12c7373e3882120332983be99aeb18d
@SQ     SN:chr3 LN:199501827    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0e48ed7f305877f66e6fd4addbae2b9a
@SQ     SN:chr4 LN:191273063    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cf37020337904229dca8401907b626c2
@SQ     SN:chr5 LN:180857866    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:031c851664e31b2c17337fd6f9004858
@SQ     SN:chr6 LN:170899992    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfe8005c536131276d448ead33f1b583
@SQ     SN:chr7 LN:158821424    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:74239c5ceee3b28f0038123d958114cb
@SQ     SN:chr8 LN:146274826    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1eb00fe1ce26ce6701d2cd75c35b5ccb
@SQ     SN:chr9 LN:140273252    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:ea244473e525dde0393d353ef94f974b
@SQ     SN:chr10        LN:135374737    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4ca41bf2d7d33578d2cd7ee9411e1533
@SQ     SN:chr11        LN:134452384    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:425ba5eb6c95b60bafbf2874493a56c3
@SQ     SN:chr12        LN:132349534    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d17d70060c56b4578fa570117bf19716
@SQ     SN:chr13        LN:114142980    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c4f3084a20380a373bbbdb9ae30da587
@SQ     SN:chr14        LN:106368585    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c1ff5d44683831e9c7c1db23f93fbb45
@SQ     SN:chr15        LN:100338915    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:5cd9622c459fe0a276b27f6ac06116d8
@SQ     SN:chr16        LN:88827254     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3e81884229e8dc6b7f258169ec8da246
@SQ     SN:chr17        LN:78774742     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2a5c95ed99c5298bb107f313c7044588
@SQ     SN:chr18        LN:76117153     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3d11df432bcdc1407835d5ef2ce62634
@SQ     SN:chr19        LN:63811651     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2f1a59077cfad51df907ac25723bff28
@SQ     SN:chr20        LN:62435964     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f126cdf8a6e0c7f379d618ff66beb2da
@SQ     SN:chr21        LN:46944323     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f1b74b7f9f4cdbaeb6832ee86cb426c6
@SQ     SN:chr22        LN:49691432     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2041e6a0c914b48dd537922cca63acb8
@SQ     SN:chrX LN:154913754    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d7e626c80ad172a4d7c95aadb94d9040
@SQ     SN:chrY LN:57772954     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:62f69d0e82a12af74bad85e2e4a8bd91
@SQ     SN:chr1_random  LN:1663265      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cc05cb1554258add2eb62e88c0746394
@SQ     SN:chr2_random  LN:185571       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:18ceab9e4667a25c8a1f67869a4356ea
@SQ     SN:chr3_random  LN:749256       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cc571e918ac18afa0b2053262cadab6
@SQ     SN:chr4_random  LN:842648       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cab2949ccf26ee0f69a875412c93740
@SQ     SN:chr5_random  LN:143687       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:05926bdbff978d4a0906862eb3f773d0
@SQ     SN:chr6_random  LN:1875562      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d62eb2919ba7b9c1d382c011c5218094
@SQ     SN:chr7_random  LN:549659       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:28ebfb89c858edbc4d71ff3f83d52231
@SQ     SN:chr8_random  LN:943810       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0ed5b088d843d6f6e6b181465b9e82ed
@SQ     SN:chr9_random  LN:1146434      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1e3d2d2f141f0550fa28a8d0ed3fd1cf
@SQ     SN:chr10_random LN:113275       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:50be2d2c6720dabeff497ffb53189daa
@SQ     SN:chr11_random LN:215294       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfc93adc30c621d5c83eee3f0d841624
@SQ     SN:chr13_random LN:186858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:563531689f3dbd691331fd6c5730a88b
@SQ     SN:chr15_random LN:784346       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bf885e99940d2d439d83eba791804a48
@SQ     SN:chr16_random LN:105485       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:dd06ea813a80b59d9c626b31faf6ae7f
@SQ     SN:chr17_random LN:2617613      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:34d5e2005dffdfaaced1d34f60ed8fc2
@SQ     SN:chr18_random LN:4262 UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f3814841f1939d3ca19072d9e89f3fd7
@SQ     SN:chr19_random LN:301858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:420ce95da035386cc8c63094288c49e2
@SQ     SN:chr21_random LN:1679693      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:a7252115bfe5bb5525f34d039eecd096
@SQ     SN:chr22_random LN:257318       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4f2d259b82f7647d3b668063cf18378b
@SQ     SN:chrX_random  LN:1719168      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f4d71e0758986c15e5455bf3e14e5d6f

Creating the fasta index file

We use the faidx command in samtools to prepare the fasta index file. This file describes byte offsets in the fasta file for each contig, allowing us to compute exactly where a particular reference base at contig:pos is in the fasta file.

> samtools faidx Homo_sapiens_assembly18.fasta 
108.446u 3.384s 2:44.61 67.9%   0+0k 0+0io 0pf+0w

This produces a text file with one record per line for each of the fasta contigs. Each record is of the: contig, size, location, basesPerLine, bytesPerLine. The index file produced above looks like:

> cat Homo_sapiens_assembly18.fasta.fai 
chrM    16571   6       50      51
chr1    247249719       16915   50      51
chr2    242951149       252211635       50      51
chr3    199501827       500021813       50      51
chr4    191273063       703513683       50      51
chr5    180857866       898612214       50      51
chr6    170899992       1083087244      50      51
chr7    158821424       1257405242      50      51
chr8    146274826       1419403101      50      51
chr9    140273252       1568603430      50      51
chr10   135374737       1711682155      50      51
chr11   134452384       1849764394      50      51
chr12   132349534       1986905833      50      51
chr13   114142980       2121902365      50      51
chr14   106368585       2238328212      50      51
chr15   100338915       2346824176      50      51
chr16   88827254        2449169877      50      51
chr17   78774742        2539773684      50      51
chr18   76117153        2620123928      50      51
chr19   63811651        2697763432      50      51
chr20   62435964        2762851324      50      51
chr21   46944323        2826536015      50      51
chr22   49691432        2874419232      50      51
chrX    154913754       2925104499      50      51
chrY    57772954        3083116535      50      51
chr1_random     1663265 3142044962      50      51
chr2_random     185571  3143741506      50      51
chr3_random     749256  3143930802      50      51
chr4_random     842648  3144695057      50      51
chr5_random     143687  3145554571      50      51
chr6_random     1875562 3145701145      50      51
chr7_random     549659  3147614232      50      51
chr8_random     943810  3148174898      50      51
chr9_random     1146434 3149137598      50      51
chr10_random    113275  3150306975      50      51
chr11_random    215294  3150422530      50      51
chr13_random    186858  3150642144      50      51
chr15_random    784346  3150832754      50      51
chr16_random    105485  3151632801      50      51
chr17_random    2617613 3151740410      50      51
chr18_random    4262    3154410390      50      51
chr19_random    301858  3154414752      50      51
chr21_random    1679693 3154722662      50      51
chr22_random    257318  3156435963      50      51
chrX_random     1719168 3156698441      50      51

1. Naming walkers

Users identify which GATK walker to run by specifying a walker name via the --analysis_type command-line argument. By default, the GATK will derive the walker name from a walker by taking the name of the walker class and removing packaging information from the start of the name, and removing the trailing text Walker from the end of the name, if it exists. For example, the GATK would, by default, assign the name PrintReads to the walker class org.broadinstitute.sting.gatk.walkers.PrintReadsWalker. To override the default walker name, annotate your walker class with @WalkerName("<my name>").

2. Requiring / allowing primary inputs

Walkers can flag exactly which primary data sources are allowed and required for a given walker. Reads, the reference, and reference-ordered data are currently considered primary data sources. Different traversal types have different default requirements for reads and reference, but currently no traversal types require reference-ordered data by default. You can add requirements to your walker with the @Requires / @Allows annotations as follows:

@Requires(DataSource.READS)
@Requires({DataSource.READS,DataSource.REFERENCE})
@Requires(value={DataSource.READS,DataSource.REFERENCE})
@Requires(value=DataSource.REFERENCE})

By default, all parameters are allowed unless you lock them down with the @Allows attribute. The command:

@Allows(value={DataSource.READS,DataSource.REFERENCE})

will only allow the reads and the reference. Any other primary data sources will cause the system to exit with an error.

Note that as of August 2011, the GATK no longer supports RMD the @Requires and @Allows syntax, as these have moved to the standard @Argument system.

3. Command-line argument tagging

Any command-line argument can be tagged with a comma-separated list of freeform tags.

The syntax for tags is as follows:

-<argument>:<tag1>,<tag2>,<tag3> <argument value>

for example:

-I:tumor <my tumor data>.bam
-eval,VCF yri.trio.chr1.vcf

There is currently no mechanism in the GATK to validate either the number of tags supplied or the content of those tags.

Tags can be accessed from within a walker by calling getToolkit().getTags(argumentValue), where argumentValue is the parsed contents of the command-line argument to inspect.

Applications

The GATK currently has comprehensive support for tags on two built-in argument types:

  • -I,--input_file <input_file>

    Input BAM files and BAM file lists can be tagged with any type. When a BAM file list is tagged, the tag is applied to each listed BAM file.

From within a walker, use the following code to access the supplied tag or tags:

getToolkit().getReaderIDForRead(read).getTags();
  • Input RODs, e.g. `-V ' or '-eval '

    Tags are used to specify ROD name and ROD type. There is currently no support for adding additional tags. See the ROD system documentation for more details.

4. Adding additional command-line arguments

Users can create command-line arguments for walkers by creating public member variables annotated with @Argument in the walker. The @Argument annotation takes a number of differentparameters:

  • fullName

    The full name of this argument. Defaults to the toLowerCase()’d member name. When specifying fullName on the command line, prefix with a double dash (--).

  • shortName

    The alternate, short name for this argument. Defaults to the first letter of the member name. When specifying shortName on the command line, prefix with a single dash (-).

  • doc

    Documentation for this argument. Will appear in help output when a user either requests help with the –-help (-h) argument or when a user specifies an invalid set of arguments. Documentation is the only argument that is always required.

  • required

    Whether the argument is required when used with this walker. Default is required = true.

  • exclusiveOf

    Specifies that this argument is mutually exclusive of another argument in the same walker. Defaults to not mutually exclusive of any other arguments.

  • validation

    Specifies a regular expression used to validate the contents of the command-line argument. If the text provided by the user does not match this regex, the GATK will abort with an error.

By default, all command-line arguments will appear in the help system. To prevent new and debugging arguments from appearing in the help system, you can add the @Hidden tag below the @Argument annotation, hiding it from the help system but allowing users to supply it on the command-line. Please use this functionality sparingly to avoid walkers with hidden command-line options that are required for production use.

Passing Command-Line Arguments

Arguments can be passed to the walker using either the full name or the short name. If passing arguments using the full name, the syntax is −−<arg full name> <value>.

--myint 6

If passing arguments using the short name, the syntax is -<arg short name> <value>. Note that there is a space between the short name and the value:

-m 6

Boolean (class) and boolean (primitive) arguments are a special in that they require no argument. The presence of a boolean indicates true, and its absence indicates false. The following example sets a flag to true.

-B

Supplemental command-line argument annotations

Two additional annotations can influence the behavior of command-line arguments.

  • @Hidden

    Adding this annotation to an @Argument tells the help system to avoid displaying any evidence that this argument exists. This can be used to add additional debugging arguments that aren't suitable for mass consumption.

  • @Deprecated

    Forces the GATK to throw an exception if this argument is supplied on the command-line. This can be used to supply extra documentation to the user as command-line parameters change for walkers that are in flux.

Examples

Create an required int parameter with full name –myint, short name -m. Pass this argument by adding –myint 6 or -m 6 to the command line.

import org.broadinstitute.sting.utils.cmdLine.Argument;
public class HelloWalker extends ReadWalker<Integer,Long> {
    @Argument(doc="my integer")
    public int myInt;

Create an optional float parameter with full name –myFloatingPointArgument, short name -m. Pass this argument by adding –myFloatingPointArgument 2.71 or -m 2.71.

import org.broadinstitute.sting.utils.cmdLine.Argument;
public class HelloWalker extends ReadWalker<Integer,Long> {
    @Argument(fullName="myFloatingPointArgument",doc="a floating point argument",required=false)
    public float myFloat;

The GATK will parse the argument differently depending on the type of the public member variable’s type. Many different argument types are supported, including primitives and their wrappers, arrays, typed and untyped collections, and any type with a String constructor. When the GATK cannot completely infer the type (such as in the case of untyped collections), it will assume that the argument is a String. GATK is aware of concrete implementations of some interfaces and abstract classes. If the argument’s member variable is of type List or Set, the GATK will fill the member variable with a concrete ArrayList or TreeSet, respectively. Maps are not currently supported.

5. Additional argument types: @Input, @Output

Besides @Argument, the GATK provides two additional types for command-line arguments: @Input and @Output. These two inputs are very similar to @Argument but act as flags to indicate dataflow to Queue, our pipeline management software.

  • The @Input tag indicates that the contents of the tagged field represents a file that will be read by the walker.

  • The @Output tag indicates that the contents of the tagged field represents a file that will be written by the walker, for consumption by downstream walkers.

We're still determining the best way to model walker dependencies in our pipeline. As we determine best practices, we'll post them here.

6. Getting access to Reference Ordered Data (RMD) with @Input and RodBinding

As of August 2011, the GATK now provides a clean mechanism for creating walker @Input arguments and using these arguments to access Reference Meta Data provided by the RefMetaDataTracker in the map() call. This mechanism is preferred to the old implicit string-based mechanism, which has been retired.

At a very high level, the new RodBindings provide a handle for a walker to obtain the Feature records from Tribble from a map() call, specific to a command line binding provided by the user. This can be as simple as a single ROD file argument|one-to-one binding between a command line argument and a track, or as complex as an argument argument accepting multiple command line arguments, each with a specific name. The RodBindings are generic and type specific, so you can require users to provide files that emit VariantContexts, BedTables, etc, or simply the root type Feature from Tribble. Critically, the RodBindings interact nicely with the GATKDocs system, so you can provide summary and detailed documentation for each RodBinding accepted by your walker.

A single ROD file argument

Suppose you have a walker that uses a single track of VariantContexts, such as SelectVariants, in its calculation. You declare a standard GATK-style @Input argument in the walker, of type RodBinding<VariantContext>:

@Input(fullName="variant", shortName = "V", doc="Select variants from this VCF file", required=true)
public RodBinding<VariantContext> variants;

This will require the user to provide a command line option --variant:vcf my.vcf to your walker. To get access to your variants, in the map() function you provide the variants variable to the tracker, as in:

Collection<VariantContext> vcs = tracker.getValues(variants, context.getLocation());

which returns all of the VariantContexts in variants that start at context.getLocation(). See RefMetaDataTracker in the javadocs to see the full range of getter routines.

Note that, as with regular tribble tracks, you have to provide the Tribble type of the file as a tag to the argument (:vcf). The system now checks up front that the corresponding Tribble codec produces Features that are type-compatible with the type of the RodBinding<T>.

RodBindings are generic

The RodBinding class is generic, parameterized as RodBinding<T extends Feature>. This T class describes the type of the Feature required by the walker. The best practice for declaring a RodBinding is to choose the most general Feature type that will allow your walker to work. For example, if all you really care about is whether a Feature overlaps the site in map, you can use Feature itself, which supports this, and will allow any Tribble type to be provided, using a RodBinding<Feature>. If you are manipulating VariantContexts, you should declare a RodBinding<VariantContext>, which will restrict automatically the user to providing Tribble types that can create a object consistent with the VariantContext class (a VariantContext itself or subclass).

Note that in multi-argument RodBindings, as List<RodBinding<T>> arg, the system will require all files provided here to provide an object of type T. So List<RodBinding<VariantContext>> arg requires all -arg command line arguments to bind to files that produce VariantContexts.

An argument that can be provided any number of times

The RodBinding system supports the standard @Argument style of allowing a vararg argument by wrapping it in a Java collection. For example, if you want to allow users to provide any number of comp tracks to your walker, simply declare a List<RodBinding<VariantContext>> field:

@Input(fullName="comp", shortName = "comp", doc="Comparison variants from this VCF file", required=true)
public List<RodBinding<VariantContext>> comps;

With this declaration, your walker will accept any number of -comp arguments, as in:

-comp:vcf 1.vcf -comp:vcf 2.vcf -comp:vcf 3.vcf

For such a command line, the comps field would be initialized to the List with three RodBindings, the first binding to 1.vcf, the second to 2.vcf and finally the third to 3.vcf.

Because this is a required argument, at least one -comp must be provided. Vararg @Input RodBindings can be optional, but you should follow proper varargs style to get the best results.

Proper handling of optional arguments

If you want to make a RodBinding optional, you first need to tell the @Input argument that its options (required=false):

@Input(fullName="discordance", required=false)
private RodBinding<VariantContext> discordanceTrack;

The GATK automagically sets this field to the value of the special static constructor method makeUnbound(Class c) to create a special "unbound" RodBinding here. This unbound object is type safe, can be safely passed to the RefMetaDataTracker get methods, and is guaranteed to never return any values. It also returns false when the isBound() method is called.

An example usage of isBound is to conditionally add header lines, as in:

if ( mask.isBound() ) {
    hInfo.add(new VCFFilterHeaderLine(MASK_NAME, "Overlaps a user-input mask"));
}

The case for vararg style RodBindings is slightly different. If you want, as above, users to be able to omit the -comp track entirely, you should initialize the value of the collection to the appropriate emptyList/emptySet in Collections:

@Input(fullName="comp", shortName = "comp", doc="Comparison variants from this VCF file", required=false)
public List<RodBinding<VariantContext>> comps = Collections.emptyList();

which will ensure that comps.isEmpty() is true when no -comp is provided.

Implicit and explicit names for RodBindings

@Input(fullName="variant", shortName = "V", doc="Select variants from this VCF file", required=true)
public RodBinding<VariantContext> variants;

By default, the getName() method in RodBinding returns the fullName of the @Input. This can be overloaded on the command-line by providing not one but two tags. The first tag is interpreted as the name for the binding, and the second as the type. As in:

-variant:vcf foo.vcf     => getName() == "variant"
-variant:foo,vcf foo.vcf => getName() == "foo"

This capability is useful when users need to provide more meaningful names for arguments, especially with variable arguments. For example, in VariantEval, there's a List<RodBinding<VariantContext>> comps, which may be dbsnp, hapmap, etc. This would be declared as:

@Input(fullName="comp", shortName = "comp", doc="Comparison variants from this VCF file", required=true)
public List<RodBinding<VariantContext>> comps;

where a normal command line usage would look like:

-comp:hapmap,vcf hapmap.vcf -comp:omni,vcf omni.vcf -comp:1000g,vcf 1000g.vcf

In the code, you might have a loop that looks like:

for ( final RodBinding comp : comps )
    for ( final VariantContext vc : tracker.getValues(comp, context.getLocation())
        out.printf("%s has a binding at %s%n", comp.getName(), getToolkit().getGenomeLocParser.createGenomeLoc(vc)); 

which would print out lines that included things like:

hapmap has a binding at 1:10
omni has a binding at 1:20
hapmap has a binding at 1:30
1000g has a binding at 1:30

This last example begs the question -- what happens with getName() when explicit names are not provided? The system goes out of its way to provide reasonable names for the variables:

  • The first occurrence is named for the fullName, where comp

  • Subsequent occurrences are postfixed with an integer count, starting at 2, so comp2, comp3, etc.

In the above example, the command line

-comp:vcf hapmap.vcf -comp:vcf omni.vcf -comp:vcf 1000g.vcf

would emit

comp has a binding at 1:10
comp2 has a binding at 1:20
comp has a binding at 1:30
comp3 has a binding at 1:30

Dynamic type resolution

The new RodBinding system supports a simple form of dynamic type resolution. If the input filetype can be specially associated with a single Tribble type (as VCF can), then you can omit the type entirely from the the command-line binding of a RodBinding!

So whereas a full command line would look like:

-comp:hapmap,vcf hapmap.vcf -comp:omni,vcf omni.vcf -comp:1000g,vcf 1000g.vcf

because these are VCF files they could technically be provided as:

-comp:hapmap hapmap.vcf -comp:omni omni.vcf -comp:1000g 1000g.vcf

If you don't care about naming, you can now say:

-comp hapmap.vcf -comp omni.vcf -comp 1000g.vcf

Best practice for documenting a RodBinding

The best practice is simple: use a javadoc style comment above the @Input annotation, with the standard first line summary and subsequent detailed discussion of the meaning of the argument. These are then picked up by the GATKdocs system and added to the standard walker docs, following the standard structure of GATKDocs @Argument docs. Below is a best practice documentation example from SelectVariants, which accepts a required variant track and two optional discordance and concordance tracks.

public class SelectVariants extends RodWalker<Integer, Integer> {
   /**
     * Variants from this file are sent through the filtering and modifying routines as directed
     * by the arguments to SelectVariants, and finally are emitted.
     */
    @Input(fullName="variant", shortName = "V", doc="Select variants from this VCF file", required=true)
    public RodBinding<VariantContext> variants;

    /**
     * A site is considered discordant if there exists some sample in eval that has a non-reference genotype
     * and either the site isn't present in this track, the sample isn't present in this track,
     * or the sample is called reference in this track.
     */
    @Input(fullName="discordance", shortName = "disc", doc="Output variants that were not called in this Feature comparison track", required=false)
    private RodBinding<VariantContext> discordanceTrack;

    /**
     * A site is considered concordant if (1) we are not looking for specific samples and there is a variant called
     * in both variants and concordance tracks or (2) every sample present in eval is present in the concordance
     * track and they have the sample genotype call.
     */
    @Input(fullName="concordance", shortName = "conc", doc="Output variants that were also called in this Feature comparison track", required=false)
    private RodBinding<VariantContext> concordanceTrack;
}

Note how much better the above version is compared to the old pre-Rodbinding syntax (code below). Below you have a required argument variant that doesn't show up as a formal argument in the GATK, different from the conceptually similar @Arguments for discordanceRodName and concordanceRodName, which have no type restrictions. There's no place to document the variant argument as well, so the system is effectively blind to this essential argument.

@Requires(value={},referenceMetaData=@RMD(name="variant", type=VariantContext.class))
public class SelectVariants extends RodWalker<Integer, Integer> {
    @Argument(fullName="discordance", shortName =  "disc", doc="Output variants that were not called on a ROD comparison track. Use -disc ROD_NAME", required=false)
    private String discordanceRodName = "";

    @Argument(fullName="concordance", shortName =  "conc", doc="Output variants that were also called on a ROD comparison track. Use -conc ROD_NAME", required=false)
    private String concordanceRodName = "";
}

RodBinding examples

In these examples, we have declared two RodBindings in the Walker

@Input(fullName="mask", doc="Input ROD mask", required=false)
public RodBinding<Feature> mask = RodBinding.makeUnbound(Feature.class);

@Input(fullName="comp", doc="Comparison track", required=false)
public List<RodBinding<VariantContext>> comps = new ArrayList<VariantContext>();
  • Get the first value

    Feature f = tracker.getFirstValue(mask)

  • Get all of the values at a location

    Collection<Feature> fs = tracker.getValues(mask, thisGenomeLoc)

  • Get all of the features here, regardless of track

    Collection<Feature> fs = tracker.getValues(Feature.class)

  • Determining if an optional RodBinding was provided . if ( mask.isBound() ) // writes out the mask header line, if one was provided hInfo.add(new VCFFilterHeaderLine(MASK_NAME, "Overlaps a user-input mask"));

    if ( ! comps.isEmpty() ) logger.info("At least one comp was provided")

Example usage in Queue scripts

In QScripts when you need to tag a file use the class TaggedFile which extends from java.io.File.

Example in the QScript on the Command Line
Untagged VCF myWalker.variant = new File("my.vcf") -V my.vcf
Tagged VCF myWalker.variant = new TaggedFile("my.vcf", "VCF") -V:VCF my.vcf
Tagged VCF myWalker.variant = new TaggedFile("my.vcf", "VCF,custom=value") -V:VCF,custom=value my.vcf
Labeling a tumor myWalker.input_file :+= new TaggedFile("mytumor.bam", "tumor") -I:tumor mytumor.bam

Notes

No longer need to (or can) use @Requires and @Allows for ROD data. This system is now retired.

1. About the RefSeq Format

From the NCBI RefSeq website

The Reference Sequence (RefSeq) collection aims to provide a comprehensive, integrated, non-redundant, well-annotated set of sequences, including genomic DNA, transcripts, and proteins. RefSeq is a foundation for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis (especially RefSeqGene records), expression studies, and comparative analyses.

2. In the GATK

The GATK uses RefSeq in a variety of walkers, from indel calling to variant annotations. There are many file format flavors of ReqSeq; we've chosen to use the table dump available from the UCSC genome table browser.

3. Generating RefSeq files

Go to the UCSC genome table browser. There are many output options, here are the changes that you'll need to make:

clade:    Mammal
genome:   Human
assembly: ''choose the appropriate assembly for the reference you're using''
group:    Genes abd Gene Prediction Tracks
track:    RefSeq Genes
table:    refGene
region:   ''choose the genome option''

Choose a good output filename, something like geneTrack.refSeq, and click the get output button. You now have your initial RefSeq file, which will not be sorted, and will contain non-standard contigs. To run with the GATK, contigs other than the standard 1-22,X,Y,MT must be removed, and the file sorted in karyotypic order. This can be done with a combination of grep, sort, and a script called sortByRef.pl that is available here.

4. Running with the GATK

You can provide your RefSeq file to the GATK like you would for any other ROD command line argument. The line would look like the following:

-[arg]:REFSEQ /path/to/refSeq

Using the filename from above.

Warning:

The GATK automatically adjusts the start and stop position of the records from zero-based half-open intervals (UCSC standard) to one-based closed intervals.

For example:

The first 19 bases in Chromsome one:
Chr1:0-19 (UCSC system)
Chr1:1-19 (GATK)

All of the GATK output is also in this format, so if you're using other tools or scripts to process RefSeq or GATK output files, you should be aware of this difference.

1. Reference Sequence

The GATK requires the reference sequence in a single reference sequence in FASTA format, with all contigs in the same file. The GATK requires strict adherence to the FASTA standard. Only the standard ACGT bases are accepted; no non-standard bases (W, for example) are tolerated. Gzipped fasta files will not work with the GATK, so please make sure to unzip them first. Please see this article for more information on preparing FASTA reference sequences for use with the GATK.

Human sequence

If you are using human data, your reads must be aligned to one of the official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The contig ordering in the reference you used must exactly match that of one of the official references canonical orderings. These are defined by historical karotyping of largest to smallest chromosomes, followed by the X, Y, and MT for the b3x references; the order is thus 1, 2, 3, ..., 10, 11, 12, ... 20, 21, 22, X, Y, MT. The hg1x references differ in that the chromosome names are prefixed with "chr" and chrM appears first instead of last. The GATK will detect misordered contigs (for example, lexicographically sorted) and throw an error. This draconian approach, though unnecessary technically, ensures that all supplementary data provided with the GATK works correctly. You can use ReorderSam to fix a BAM file aligned to a missorted reference sequence.

Our Best Practice recommendation is that you use a standard GATK reference from the GATK resource bundle.

2. Sequencing Reads

The only input format for NGS reads that the GATK supports is the [Sequence Alignment/Map (SAM)] format. See [SAM/BAM] for more details on the SAM/BAM format as well as Samtools and Picard, two complementary sets of utilities for working with SAM/BAM files.

In addition to being in SAM format, we require the following additional constraints in order to use your file with the GATK:

  • The file must be binary (with .bam file extension).
  • The file must be indexed.
  • The file must be sorted in coordinate order with respect to the reference (i.e. the contig ordering in your bam must exactly match that of the reference you are using).
  • The file must have a proper bam header with read groups. Each read group must contain the platform (PL) and sample (SM) tags. For the platform value, we currently support 454, LS454, Illumina, Solid, ABI_Solid, and CG (all case-insensitive).
  • Each read in the file must be associated with exactly one read group.

Below is an example well-formed SAM field header and fields from the 1000 Genomes Project:

@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:249250621    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1b22b98cdeb4a9304cb5d48026a85128
@SQ     SN:2    LN:243199373    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a0d9851da00400dec1098a9255ac712e
@SQ     SN:3    LN:198022430    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:fdfd811849cc2fadebc929bb925902e5
@SQ     SN:4    LN:191154276    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:23dccd106897542ad87d2765d28a19a1
@SQ     SN:5    LN:180915260    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:0740173db9ffd264d728f32784845cd7
@SQ     SN:6    LN:171115067    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1d3a93a248d92a729ee764823acbbc6b
@SQ     SN:7    LN:159138663    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:618366e953d6aaad97dbe4777c29375e
@SQ     SN:8    LN:146364022    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:96f514a9929e410c6651697bded59aec
@SQ     SN:9    LN:141213431    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:3e273117f15e0a400f01055d9f393768
@SQ     SN:10   LN:135534747    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:988c28e000e84c26d552359af1ea2e1d
@SQ     SN:11   LN:135006516    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:98c59049a2df285c76ffb1c6db8f8b96
@SQ     SN:12   LN:133851895    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:51851ac0e1a115847ad36449b0015864
@SQ     SN:13   LN:115169878    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:283f8d7892baa81b510a015719ca7b0b
@SQ     SN:14   LN:107349540    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:98f3cae32b2a2e9524bc19813927542e
@SQ     SN:15   LN:102531392    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:e5645a794a8238215b2cd77acb95a078
@SQ     SN:16   LN:90354753     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:fc9b1a7b42b97a864f56b348b06095e6
@SQ     SN:17   LN:81195210     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:351f64d4f4f9ddd45b35336ad97aa6de
@SQ     SN:18   LN:78077248     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c
@SQ     SN:19   LN:59128983     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1aacd71f30db8e561810913e0b72636d
@SQ     SN:20   LN:63025520     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:0dec9660ec1efaaf33281c0d5ea2560f
@SQ     SN:21   LN:48129895     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:2979a6085bfe28e3ad6f552f361ed74d
@SQ     SN:22   LN:51304566     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a718acaa6135fdca8357d5bfe94211dd
@SQ     SN:X    LN:155270560    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:7e0e2e580297b7764e31dbc80c2540dd
@SQ     SN:Y    LN:59373566     AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1fa3474750af0948bdf97d5a0ee52e51
@SQ     SN:MT   LN:16569        AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:c68f52674c9fb33aef52dcf399755519
@RG     ID:ERR000162    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR000252    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001684    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001685    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001686    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001687    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001688    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001689    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001690    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002307    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002308    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002309    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002310    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002311    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002312    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002313    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR002434    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@PG     ID:GATK TableRecalibration      VN:v2.2.16      CL:Covariates=[ReadGroupCovariate, QualityScoreCovariate, DinucCovariate, CycleCovariate], use_original_quals=true, defau 
t_read_group=DefaultReadGroup, default_platform=Illumina, force_read_group=null, force_platform=null, solid_recal_mode=SET_Q_ZERO, window_size_nqs=5, homopolymer_nback=7, except on_if_no_tile=false, pQ=5, maxQ=40, smoothing=137       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b4eb71ee878d3706246b7c1dbef69299
@PG     ID:bwa  VN:0.5.5
ERR001685.4315085       16      1       9997    25      35M     *       0       0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     ?8:C7ACAABBCBAAB?CCAABBEBA@ACEBBB@?     XT:A:U  XN:i:4    X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001685  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:>>:>2>>>>>>>>>>>>>>>>>>?>>>>??>???>
ERR001689.1165834       117     1       9997    0       *       =       9997    0       CCGATCTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     >7AA<@@C?@?B?B??>9?B??>A?B???BAB??@     RG:Z:ERR001689    OQ:Z:>:<<8<<<><<><><<>7<>>>?>>??>???????
ERR001689.1165834       185     1       9997    25      35M     =       9997    0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     758A:?>>8?=@@>>?;4<>=??@@==??@?==?8     XT:A:U  XN:i:4    SM:i:25 AM:i:0  X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001689  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:;74>7><><><>>>>><:<>>>>>>>>>>>>>>>>
ERR001688.2681347       117     1       9998    0       *       =       9998    0       CGATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     5@BA@A6B???A?B??>B@B??>B@B??>BAB???     RG:Z:ERR001688    OQ:Z:=>>>><4><<?><??????????????????????       

Fixing BAM files with alternative sortings

The GATK requires that the BAM file be sorted in the same order as the reference. Unfortunately, many BAM files have headers that are sorted in some other order -- lexicographical order is a common alternative. To resort the BAM file please use ReorderSam.

3. Intervals

The GATK accept interval files for processing subsets of the genome in Picard-style interval lists. These files have a .interval_list extension and look like this:

@HD     VN:1.0  SO:coordinate
@SQ     SN:1    LN:249250621    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1b22b98cdeb4a9304cb5d48026a85128     SP:Homo Sapiens
@SQ     SN:2    LN:243199373    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a0d9851da00400dec1098a9255ac712e     SP:Homo Sapiens
@SQ     SN:3    LN:198022430    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:fdfd811849cc2fadebc929bb925902e5     SP:Homo Sapiens
@SQ     SN:4    LN:191154276    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:23dccd106897542ad87d2765d28a19a1     SP:Homo Sapiens
@SQ     SN:5    LN:180915260    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:0740173db9ffd264d728f32784845cd7     SP:Homo Sapiens
@SQ     SN:6    LN:171115067    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1d3a93a248d92a729ee764823acbbc6b     SP:Homo Sapiens
@SQ     SN:7    LN:159138663    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:618366e953d6aaad97dbe4777c29375e     SP:Homo Sapiens
@SQ     SN:8    LN:146364022    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:96f514a9929e410c6651697bded59aec     SP:Homo Sapiens
@SQ     SN:9    LN:141213431    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:3e273117f15e0a400f01055d9f393768     SP:Homo Sapiens
@SQ     SN:10   LN:135534747    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:988c28e000e84c26d552359af1ea2e1d     SP:Homo Sapiens
@SQ     SN:11   LN:135006516    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:98c59049a2df285c76ffb1c6db8f8b96     SP:Homo Sapiens
@SQ     SN:12   LN:133851895    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:51851ac0e1a115847ad36449b0015864     SP:Homo Sapiens
@SQ     SN:13   LN:115169878    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:283f8d7892baa81b510a015719ca7b0b     SP:Homo Sapiens
@SQ     SN:14   LN:107349540    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:98f3cae32b2a2e9524bc19813927542e     SP:Homo Sapiens
@SQ     SN:15   LN:102531392    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:e5645a794a8238215b2cd77acb95a078     SP:Homo Sapiens
@SQ     SN:16   LN:90354753     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:fc9b1a7b42b97a864f56b348b06095e6     SP:Homo Sapiens
@SQ     SN:17   LN:81195210     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:351f64d4f4f9ddd45b35336ad97aa6de     SP:Homo Sapiens
@SQ     SN:18   LN:78077248     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c     SP:Homo Sapiens
@SQ     SN:19   LN:59128983     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1aacd71f30db8e561810913e0b72636d     SP:Homo Sapiens
@SQ     SN:20   LN:63025520     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:0dec9660ec1efaaf33281c0d5ea2560f     SP:Homo Sapiens
@SQ     SN:21   LN:48129895     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:2979a6085bfe28e3ad6f552f361ed74d     SP:Homo Sapiens
@SQ     SN:22   LN:51304566     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a718acaa6135fdca8357d5bfe94211dd     SP:Homo Sapiens
@SQ     SN:X    LN:155270560    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:7e0e2e580297b7764e31dbc80c2540dd     SP:Homo Sapiens
@SQ     SN:Y    LN:59373566     AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1fa3474750af0948bdf97d5a0ee52e51     SP:Homo Sapiens
@SQ     SN:MT   LN:16569        AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:c68f52674c9fb33aef52dcf399755519     SP:Homo Sapiens
1       30366   30503   +       target_1
1       69089   70010   +       target_2
1       367657  368599  +       target_3
1       621094  622036  +       target_4
1       861320  861395  +       target_5
1       865533  865718  +       target_6
...

consisting of a SAM-file-like sequence dictionary (the header), and targets in the form of + . These interval lists are tab-delimited. They are also 1-based (first position in the genome is position 1, not position 0). The easiest way to create such a file is to combine your reference file's sequence dictionary (the file stored alongside the reference fasta file with the .dict extension) and your intervals into one file.

You can also specify a list of intervals in a .interval_list file formatted as :- (one interval per line). No sequence dictionary is necessary. This file uses 1-based coordinates.

Finally, we also accept BED style interval lists. Warning: this file format is 0-based for the start coordinates, so coordinates taken from 1-based formats should be offset by 1.

4. Reference Ordered Data (ROD) file formats

The GATK can associate arbitrary reference ordered data (ROD) files with named tracks for all tools. Some tools require specific ROD data files for processing, and developers are free to write tools that access arbitrary data sets using the ROD interface. The general ROD system has the following syntax:

-argumentName:name,type file

Where name is the name in the GATK tool (like "eval" in VariantEval), type is the type of the file, such as VCF or dbSNP, and file is the path to the file containing the ROD data.

The GATK supports several common file formats for reading ROD data:

  • VCF : VCF type, the recommended format for representing variant loci and genotype calls. The GATK will only process valid VCF files; VCFTools provides the official VCF validator. See [here] for a useful poster detailing the VCF specification.
  • UCSC formated dbSNP : dbSNP type, UCSC dbSNP database output
  • BED : BED type, a general purpose format for representing genomic interval data, useful for masks and other interval outputs. Please note that the bed format is 0-based while most other formats are 1-based.

Note that we no longer support the PED format. See here for converting .ped files to VCF.

Sorry, there are no publicly available documents of this type with the tag #inputs. Try one of the other types.
Sorry, there are no publicly available documents of this type with the tag #inputs. Try one of the other types.