Tagged with #fastareference
4 documentation articles | 0 announcements | 0 forum discussions


Comments (15)

This article describes the steps necessary to prepare your reference file (if it's not one that you got from us). As a complement to this article, see the relevant tutorial.

Why these steps are necessary

The GATK uses two files to access and safety check access to the reference files: a .dict dictionary of the contig names and sizes and a .fai fasta index file to allow efficient random access to the reference bases. You have to generate these files in order to be able to use a Fasta file as reference.

NOTE: Picard and samtools treat spaces in contig names differently. We recommend that you avoid using spaces in contig names.

Creating the fasta sequence dictionary file

We use CreateSequenceDictionary.jar from Picard to create a .dict file from a fasta file.

> java -jar CreateSequenceDictionary.jar R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:11 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:58 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary done.
Runtime.totalMemory()=2112487424
44.922u 2.308s 0:47.09 100.2%   0+0k 0+0io 2pf+0w

This produces a SAM-style header file describing the contents of our fasta file.

> cat Homo_sapiens_assembly18.dict 
@HD     VN:1.0  SO:unsorted
@SQ     SN:chrM LN:16571        UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d2ed829b8a1628d16cbeee88e88e39eb
@SQ     SN:chr1 LN:247249719    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9ebc6df9496613f373e73396d5b3b6b6
@SQ     SN:chr2 LN:242951149    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:b12c7373e3882120332983be99aeb18d
@SQ     SN:chr3 LN:199501827    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0e48ed7f305877f66e6fd4addbae2b9a
@SQ     SN:chr4 LN:191273063    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cf37020337904229dca8401907b626c2
@SQ     SN:chr5 LN:180857866    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:031c851664e31b2c17337fd6f9004858
@SQ     SN:chr6 LN:170899992    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfe8005c536131276d448ead33f1b583
@SQ     SN:chr7 LN:158821424    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:74239c5ceee3b28f0038123d958114cb
@SQ     SN:chr8 LN:146274826    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1eb00fe1ce26ce6701d2cd75c35b5ccb
@SQ     SN:chr9 LN:140273252    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:ea244473e525dde0393d353ef94f974b
@SQ     SN:chr10        LN:135374737    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4ca41bf2d7d33578d2cd7ee9411e1533
@SQ     SN:chr11        LN:134452384    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:425ba5eb6c95b60bafbf2874493a56c3
@SQ     SN:chr12        LN:132349534    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d17d70060c56b4578fa570117bf19716
@SQ     SN:chr13        LN:114142980    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c4f3084a20380a373bbbdb9ae30da587
@SQ     SN:chr14        LN:106368585    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c1ff5d44683831e9c7c1db23f93fbb45
@SQ     SN:chr15        LN:100338915    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:5cd9622c459fe0a276b27f6ac06116d8
@SQ     SN:chr16        LN:88827254     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3e81884229e8dc6b7f258169ec8da246
@SQ     SN:chr17        LN:78774742     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2a5c95ed99c5298bb107f313c7044588
@SQ     SN:chr18        LN:76117153     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3d11df432bcdc1407835d5ef2ce62634
@SQ     SN:chr19        LN:63811651     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2f1a59077cfad51df907ac25723bff28
@SQ     SN:chr20        LN:62435964     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f126cdf8a6e0c7f379d618ff66beb2da
@SQ     SN:chr21        LN:46944323     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f1b74b7f9f4cdbaeb6832ee86cb426c6
@SQ     SN:chr22        LN:49691432     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2041e6a0c914b48dd537922cca63acb8
@SQ     SN:chrX LN:154913754    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d7e626c80ad172a4d7c95aadb94d9040
@SQ     SN:chrY LN:57772954     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:62f69d0e82a12af74bad85e2e4a8bd91
@SQ     SN:chr1_random  LN:1663265      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cc05cb1554258add2eb62e88c0746394
@SQ     SN:chr2_random  LN:185571       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:18ceab9e4667a25c8a1f67869a4356ea
@SQ     SN:chr3_random  LN:749256       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cc571e918ac18afa0b2053262cadab6
@SQ     SN:chr4_random  LN:842648       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cab2949ccf26ee0f69a875412c93740
@SQ     SN:chr5_random  LN:143687       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:05926bdbff978d4a0906862eb3f773d0
@SQ     SN:chr6_random  LN:1875562      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d62eb2919ba7b9c1d382c011c5218094
@SQ     SN:chr7_random  LN:549659       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:28ebfb89c858edbc4d71ff3f83d52231
@SQ     SN:chr8_random  LN:943810       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0ed5b088d843d6f6e6b181465b9e82ed
@SQ     SN:chr9_random  LN:1146434      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1e3d2d2f141f0550fa28a8d0ed3fd1cf
@SQ     SN:chr10_random LN:113275       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:50be2d2c6720dabeff497ffb53189daa
@SQ     SN:chr11_random LN:215294       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfc93adc30c621d5c83eee3f0d841624
@SQ     SN:chr13_random LN:186858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:563531689f3dbd691331fd6c5730a88b
@SQ     SN:chr15_random LN:784346       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bf885e99940d2d439d83eba791804a48
@SQ     SN:chr16_random LN:105485       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:dd06ea813a80b59d9c626b31faf6ae7f
@SQ     SN:chr17_random LN:2617613      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:34d5e2005dffdfaaced1d34f60ed8fc2
@SQ     SN:chr18_random LN:4262 UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f3814841f1939d3ca19072d9e89f3fd7
@SQ     SN:chr19_random LN:301858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:420ce95da035386cc8c63094288c49e2
@SQ     SN:chr21_random LN:1679693      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:a7252115bfe5bb5525f34d039eecd096
@SQ     SN:chr22_random LN:257318       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4f2d259b82f7647d3b668063cf18378b
@SQ     SN:chrX_random  LN:1719168      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f4d71e0758986c15e5455bf3e14e5d6f

Creating the fasta index file

We use the faidx command in samtools to prepare the fasta index file. This file describes byte offsets in the fasta file for each contig, allowing us to compute exactly where a particular reference base at contig:pos is in the fasta file.

> samtools faidx Homo_sapiens_assembly18.fasta 
108.446u 3.384s 2:44.61 67.9%   0+0k 0+0io 0pf+0w

This produces a text file with one record per line for each of the fasta contigs. Each record is of the: contig, size, location, basesPerLine, bytesPerLine. The index file produced above looks like:

> cat Homo_sapiens_assembly18.fasta.fai 
chrM    16571   6       50      51
chr1    247249719       16915   50      51
chr2    242951149       252211635       50      51
chr3    199501827       500021813       50      51
chr4    191273063       703513683       50      51
chr5    180857866       898612214       50      51
chr6    170899992       1083087244      50      51
chr7    158821424       1257405242      50      51
chr8    146274826       1419403101      50      51
chr9    140273252       1568603430      50      51
chr10   135374737       1711682155      50      51
chr11   134452384       1849764394      50      51
chr12   132349534       1986905833      50      51
chr13   114142980       2121902365      50      51
chr14   106368585       2238328212      50      51
chr15   100338915       2346824176      50      51
chr16   88827254        2449169877      50      51
chr17   78774742        2539773684      50      51
chr18   76117153        2620123928      50      51
chr19   63811651        2697763432      50      51
chr20   62435964        2762851324      50      51
chr21   46944323        2826536015      50      51
chr22   49691432        2874419232      50      51
chrX    154913754       2925104499      50      51
chrY    57772954        3083116535      50      51
chr1_random     1663265 3142044962      50      51
chr2_random     185571  3143741506      50      51
chr3_random     749256  3143930802      50      51
chr4_random     842648  3144695057      50      51
chr5_random     143687  3145554571      50      51
chr6_random     1875562 3145701145      50      51
chr7_random     549659  3147614232      50      51
chr8_random     943810  3148174898      50      51
chr9_random     1146434 3149137598      50      51
chr10_random    113275  3150306975      50      51
chr11_random    215294  3150422530      50      51
chr13_random    186858  3150642144      50      51
chr15_random    784346  3150832754      50      51
chr16_random    105485  3151632801      50      51
chr17_random    2617613 3151740410      50      51
chr18_random    4262    3154410390      50      51
chr19_random    301858  3154414752      50      51
chr21_random    1679693 3154722662      50      51
chr22_random    257318  3156435963      50      51
chrX_random     1719168 3156698441      50      51
Comments (62)

All analyses done with the GATK typically involve several (though not necessarily all) of the following inputs:

  • Reference genome sequence
  • Sequencing reads
  • Intervals of interest
  • Reference-ordered data

This article describes the corresponding file formats that are acceptable for use with the GATK.

1. Reference Genome Sequence

The GATK requires the reference sequence in a single reference sequence in FASTA format, with all contigs in the same file. The GATK requires strict adherence to the FASTA standard. All the standard IUPAC bases are accepted, but keep in mind that non-standard bases (i.e. other than ACGT, such as W for example) will be ignored (i.e. those positions in the genome will be skipped).

Some users have reported having issues with reference files that have been stored or modified on Windows filesystems. The issues manifest as "10" characters (corresponding to encoded newlines) inserted in the sequence, which cause the GATK to quit with an error. If you encounter this issue, you will need to re-download a valid master copy of the reference file, or clean it up yourself.

Gzipped fasta files will not work with the GATK, so please make sure to unzip them first. Please see this article for more information on preparing FASTA reference sequences for use with the GATK.

Important note about human genome reference versions

If you are using human data, your reads must be aligned to one of the official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The contig ordering in the reference you used must exactly match that of one of the official references canonical orderings. These are defined by historical karotyping of largest to smallest chromosomes, followed by the X, Y, and MT for the b3x references; the order is thus 1, 2, 3, ..., 10, 11, 12, ... 20, 21, 22, X, Y, MT. The hg1x references differ in that the chromosome names are prefixed with "chr" and chrM appears first instead of last. The GATK will detect misordered contigs (for example, lexicographically sorted) and throw an error. This draconian approach, though unnecessary technically, ensures that all supplementary data provided with the GATK works correctly. You can use ReorderSam to fix a BAM file aligned to a missorted reference sequence.

Our Best Practice recommendation is that you use a standard GATK reference from the GATK resource bundle.

2. Sequencing Reads

The only input format for sequence reads that the GATK itself supports is the [Sequence Alignment/Map (SAM)] format. See [SAM/BAM] for more details on the SAM/BAM format as well as Samtools and Picard, two complementary sets of utilities for working with SAM/BAM files.

If you don't find the information you need in this section, please see our FAQs on BAM files.

If you are starting out your pipeline with raw reads (typically in FASTQ format) you'll need to make sure that when you map those reads to the reference and produce a BAM file, the resulting BAM file is fully compliant with the GATK requirements. See the Best Practices documentation for detailed instructions on how to do this.

In addition to being in SAM format, we require the following additional constraints in order to use your file with the GATK:

  • The file must be binary (with .bam file extension).
  • The file must be indexed.
  • The file must be sorted in coordinate order with respect to the reference (i.e. the contig ordering in your bam must exactly match that of the reference you are using).
  • The file must have a proper bam header with read groups. Each read group must contain the platform (PL) and sample (SM) tags. For the platform value, we currently support 454, LS454, Illumina, Solid, ABI_Solid, and CG (all case-insensitive).
  • Each read in the file must be associated with exactly one read group.

Below is an example well-formed SAM field header and fields (with @SQ dictionary truncated to show only the first two chromosomes for brevity):

@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:249250621    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1b22b98cdeb4a9304cb5d48026a85128
@SQ     SN:2    LN:243199373    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a0d9851da00400dec1098a9255ac712e
@RG     ID:ERR000162    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR000252    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001684    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001685    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@PG     ID:GATK TableRecalibration      VN:v2.2.16      CL:Covariates=[ReadGroupCovariate, QualityScoreCovariate, DinucCovariate, CycleCovariate], use_original_quals=true, defau 
t_read_group=DefaultReadGroup, default_platform=Illumina, force_read_group=null, force_platform=null, solid_recal_mode=SET_Q_ZERO, window_size_nqs=5, homopolymer_nback=7, except on_if_no_tile=false, pQ=5, maxQ=40, smoothing=137       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b4eb71ee878d3706246b7c1dbef69299
@PG     ID:bwa  VN:0.5.5
ERR001685.4315085       16      1       9997    25      35M     *       0       0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     ?8:C7ACAABBCBAAB?CCAABBEBA@ACEBBB@?     XT:A:U  XN:i:4    X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001685  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:>>:>2>>>>>>>>>>>>>>>>>>?>>>>??>???>
ERR001689.1165834       117     1       9997    0       *       =       9997    0       CCGATCTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     >7AA<@@C?@?B?B??>9?B??>A?B???BAB??@     RG:Z:ERR001689    OQ:Z:>:<<8<<<><<><><<>7<>>>?>>??>???????
ERR001689.1165834       185     1       9997    25      35M     =       9997    0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     758A:?>>8?=@@>>?;4<>=??@@==??@?==?8     XT:A:U  XN:i:4    SM:i:25 AM:i:0  X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001689  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:;74>7><><><>>>>><:<>>>>>>>>>>>>>>>>
ERR001688.2681347       117     1       9998    0       *       =       9998    0       CGATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     5@BA@A6B???A?B??>B@B??>B@B??>BAB???     RG:Z:ERR001688    OQ:Z:=>>>><4><<?><??????????????????????       

Note about fixing BAM files with alternative sortings

The GATK requires that the BAM file be sorted in the same order as the reference. Unfortunately, many BAM files have headers that are sorted in some other order -- lexicographical order is a common alternative. To resort the BAM file please use ReorderSam.

3. Intervals of interest

If you don't find the information you need in this section, please see our FAQs on interval lists.

The GATK accept interval files for processing subsets of the genome in Picard-style interval lists. These files typically have an extension such as '.list' or more explicitly,.interval_list`, and look like this:

@HD     VN:1.0  SO:coordinate
@SQ     SN:1    LN:249250621    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1b22b98cdeb4a9304cb5d48026a85128     SP:Homo Sapiens
@SQ     SN:2    LN:243199373    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a0d9851da00400dec1098a9255ac712e     SP:Homo Sapiens
1       30366   30503   +       target_1
1       69089   70010   +       target_2
1       367657  368599  +       target_3
1       621094  622036  +       target_4
1       861320  861395  +       target_5
1       865533  865718  +       target_6
...

consisting of aSAM-file-like sequence dictionary (the header), and targets in the form of <chr> <start> <stop> + <target_name>. These interval lists are tab-delimited. They are also 1-based (first position in the genome is position 1, not position 0). The easiest way to create such a file is to combine your reference file's sequence dictionary (the file stored alongside the reference fasta file with the .dict extension) and your intervals into one file.

You can also specify a list of intervals formatted as <chr>:<start>-<stop> (one interval per line). No sequence dictionary is necessary. This file format also uses 1-based coordinates.

Finally, we also accept BED style interval lists. Warning: this file format is 0-based for the start coordinates, so coordinates taken from 1-based formats should be offset by 1.

4. Reference Ordered Data (ROD) file formats

The GATK can associate arbitrary reference ordered data (ROD) files with named tracks for all tools. Some tools require specific ROD data files for processing, and developers are free to write tools that access arbitrary data sets using the ROD interface. The general ROD system has the following syntax:

-argumentName:name,type file

Where name is the name in the GATK tool (like "eval" in VariantEval), type is the type of the file, such as VCF or dbSNP, and file is the path to the file containing the ROD data.

The GATK supports several common file formats for reading ROD data:

  • VCF : VCF type, the recommended format for representing variant loci and genotype calls. The GATK will only process valid VCF files; VCFTools provides the official VCF validator. See here for a useful poster detailing the VCF specification.
  • UCSC formated dbSNP : dbSNP type, UCSC dbSNP database output
  • BED : BED type, a general purpose format for representing genomic interval data, useful for masks and other interval outputs. Please note that the bed format is 0-based while most other formats are 1-based.

Note that we no longer support the PED format. See here for converting .ped files to VCF.

If you need additional information on VCF files, please see our FAQs on VCF files here and here.

Comments (2)

A new tool has been released!

Check out the documentation at FastaReference.

Comments (38)

liftOverVCF.pl

Contents

Introduction

This script converts a VCF file from one reference build to another. It runs 3 modules within our toolkit that are necessary for lifting over a VCF.
1. LiftoverVariants walker
2. sortByRef.pl to sort the lifted-over file
3. Filter out records whose ref field no longer matches the new reference

Obtaining the Script

The liftOverVCF.pl script is available in our public source repository under the 'perl' directory. Instructions for pulling down our source are available here.

Example

./liftOverVCF.pl -vcf calls.b36.vcf \
  -chain b36ToHg19.broad.over.chain \
  -out calls.hg19.vcf \
  -gatk /humgen/gsa-scr1/ebanks/Sting_dev
  -newRef /seq/references/Homo_sapiens_assembly19/v0/Homo_sapiens_assembly19
  -oldRef /humgen/1kg/reference/human_b36_both
  -tmp /broad/shptmp [defaults to /tmp]

Usage

Running the script with no arguments will show the usage:

Usage: liftOverVCF.pl
    -vcf        <input vcf>
    -gatk       <path to gatk trunk>
    -chain      <chain file>
    -newRef     <path to new reference prefix; we will need newRef.dict, .fasta, and .fasta.fai>
    -oldRef     <path to old reference prefix; we will need oldRef.fasta>
    -out        <output vcf>
    -tmp            <temp file location; defaults to /tmp>
  • The 'tmp' argument is optional. It specifies the location to write the temporary file from step 1 of the process.


Chain files

Chain files from b36/hg18 to hg19 are located here within the Broad:

   /humgen/gsa-hpprojects/GATK/data/Liftover_Chain_Files/

External users can get them off our ftp site:

   location: ftp.broadinstitute.org
   username: gsapubftp-anonymous
   path:     Liftover_Chain_Files
No posts found with the requested search criteria.
No posts found with the requested search criteria.