The GATK supports the BAM format for reads, quality scores, alignments, and metadata (e.g. the lane of sequencing, center of origin, sample name, etc.). No other file formats are supported.
The GATK doesn't have any tools for getting data into BAM format, but many other toolkits exist for this purpose. We recommend you look at Picard and Samtools for creating and manipulating BAM files. Also, many aligners are starting to emit BAM files directly. See BWA for one such aligner.
All BAM files must satisfy the following requirements:
See the BAM specification for more information.
It depends on whether you're using the NCBI/GRC build 36/build 37 version of the human genome, or the UCSC hg18/hg19 version of the human genome. While substantially equivalent, the naming conventions are different. The canonical ordering of contigs for these genomes is as follows:
Human genome reference consortium standard ordering and names (b3x): 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, Y, MT...
UCSC convention (hg1x): chrM, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, chr19, chr20, chr21, chr22, chrX, chrY...
The easiest way to do it is to download Samtools and run the following command to examine the header of your file:
$ samtools view -H /path/to/my.bam
@HD VN:1.0 GO:none SO:coordinate
@SQ SN:1 LN:247249719
@SQ SN:2 LN:242951149
@SQ SN:3 LN:199501827
@SQ SN:4 LN:191273063
@SQ SN:5 LN:180857866
@SQ SN:6 LN:170899992
@SQ SN:7 LN:158821424
@SQ SN:8 LN:146274826
@SQ SN:9 LN:140273252
@SQ SN:10 LN:135374737
@SQ SN:11 LN:134452384
@SQ SN:12 LN:132349534
@SQ SN:13 LN:114142980
@SQ SN:14 LN:106368585
@SQ SN:15 LN:100338915
@SQ SN:16 LN:88827254
@SQ SN:17 LN:78774742
@SQ SN:18 LN:76117153
@SQ SN:19 LN:63811651
@SQ SN:20 LN:62435964
@SQ SN:21 LN:46944323
@SQ SN:22 LN:49691432
@SQ SN:X LN:154913754
@SQ SN:Y LN:57772954
@SQ SN:MT LN:16571
@SQ SN:NT_113887 LN:3994
...
If the order of the contigs here matches the contig ordering specified above, and the SO:coordinate flag appears in your header, then your contig and read ordering satisfies the GATK requirements.
Picard offers a tool called SortSam that will sort a BAM file properly. A similar utility exists in Samtools, but we recommend the Picard tool because SortSam will also set a flag in the header that specifies that the file is correctly sorted, and this flag is necessary for the GATK to know it is safe to process the data. Also, you can use the ReorderSam command to make a BAM file SQ order match another reference sequence.
A quick Unix command using Samtools will do the trick:
$ samtools view -H /path/to/my.bam | grep '^@RG'
@RG ID:0 PL:solid PU:Solid0044_20080829_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP LB:Lib1 PI:2750 DT:2008-08-28T20:00:00-0400 SM:NA12414 CN:bcm
@RG ID:1 PL:solid PU:0083_BCM_20080719_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP LB:Lib1 PI:2750 DT:2008-07-18T20:00:00-0400 SM:NA12414 CN:bcm
@RG ID:2 PL:LS454 PU:R_2008_10_02_06_06_12_FLX01080312_retry LB:HL#01_NA11881 PI:0 SM:NA11881 CN:454MSC
@RG ID:3 PL:LS454 PU:R_2008_10_02_06_07_08_rig19_retry LB:HL#01_NA11881 PI:0 SM:NA11881 CN:454MSC
@RG ID:4 PL:LS454 PU:R_2008_10_02_17_50_32_FLX03080339_retry LB:HL#01_NA11881 PI:0 SM:NA11881 CN:454MSC
...
The presence of the @RG tags indicate the presence of read groups. Each read group has a SM tag, indicating the sample from which the reads belonging to that read group originate.
In addition to the presence of a read group in the header, each read must belong to one and only one read group. Given the following example reads,
$ samtools view /path/to/my.bam | grep '^@RG'
EAS139_44:2:61:681:18781 35 1 1 0 51M = 9 59 TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA B<>;==?=?<==?=?=>>?>><=<?=?8<=?>?<:=?>?<==?=>:;<?:= RG:Z:4 MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:31
EAS139_44:7:84:1300:7601 35 1 1 0 51M = 12 62 TAACCCTAAGCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA G<>;==?=?&=>?=?<==?>?<>>?=?<==?>?<==?>?1==@>?;<=><; RG:Z:3 MF:i:18 Aq:i:0 NM:i:1 UQ:i:5 H0:i:0 H1:i:85
EAS139_44:8:59:118:13881 35 1 1 0 51M = 2 52 TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>;<=?=?==>?>?<==?=><=>?-?;=>?:><==?7?;<>?5?<<=>:; RG:Z:1 MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:31
EAS139_46:3:75:1326:2391 35 1 1 0 51M = 12 62 TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>==>?>@???B>A>?>A?A>??A?@>?@A?@;??A>@7>?>>@:>=@;@ RG:Z:0 MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:31
...
membership in a read group is specified by the RG:Z:* tag. For instance, the first read belongs to read group 4 (sample NA11881), while the last read shown here belongs to read group 0 (sample NA12414).
Yes! Many algorithms in the GATK need to know that certain reads were sequenced together on a specific lane, as they attempt to compensate for variability from one sequencing run to the next. Others need to know that the data represents not just one, but many samples. Without the read group and sample information, the GATK has no way of determining this critical information.
For technical details, see the SAM specification on the Samtools website.
| Tag | Importance | SAM spec definition | Meaning |
|---|---|---|---|
ID |
Required | Read group identifier. Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section. Read groupIDs may be modified when merging SAM files in order to handle collisions. |
Ideally, this should be a globally unique identify across all sequencing data in the world, such as the Illumina flowcell + lane name and number. Will be referenced by each read with the RG:Z field, allowing tools to determine the read group information associated with each read, including the sample from which the read came. Also, a read group is effectively treated as a separate run of the NGS instrument in tools like base quality score recalibration -- all reads within a read group are assumed to come from the same instrument run and to therefore share the same error model. |
SM |
Sample. Use pool name where a pool is being sequenced. | Required. As important as ID. |
The name of the sample sequenced in this read group. GATK tools treat all read groups with the same SM value as containing sequencing data for the same sample. Therefore it's critical that the SM field be correctly specified, especially when using multi-sample tools like the Unified Genotyper. |
PL |
Platform/technology used to produce the read. Valid values: ILLUMINA, SOLID, LS454, HELICOS and PACBIO. | Important. Not currently used in the GATK, but was in the past, and may return. The only way to known the sequencing technology used to generate the sequencing data . | It's a good idea to use this field. |
LB |
DNA preparation library identify | Essential for MarkDuplicates | MarkDuplicates uses the LB field to determine which read groups might contain molecular duplicates, in case the same DNA library was sequenced on multiple lanes. |
We do not require value for the CN, DS, DT, PG, PI, or PU fields.
A concrete example may be instructive. Suppose I have a trio of samples: MOM, DAD, and KID. Each has two DNA libraries prepared, one with 400 bp inserts and another with 200 bp inserts. Each of these libraries is run on two lanes of an Illumina HiSeq, requiring 3 x 2 x 2 = 12 lanes of data. When the data come off the sequencer, I would create 12 bam files, with the following @RG fields in the header:
Dad's data:
@RG ID:FLOWCELL1.LANE1 PL:ILLUMINA LB:LIB-DAD-1 SM:DAD PI:200
@RG ID:FLOWCELL1.LANE2 PL:ILLUMINA LB:LIB-DAD-1 SM:DAD PI:200
@RG ID:FLOWCELL1.LANE3 PL:ILLUMINA LB:LIB-DAD-2 SM:DAD PI:400
@RG ID:FLOWCELL1.LANE4 PL:ILLUMINA LB:LIB-DAD-2 SM:DAD PI:400
Mom's data:
@RG ID:FLOWCELL1.LANE5 PL:ILLUMINA LB:LIB-MOM-1 SM:MOM PI:200
@RG ID:FLOWCELL1.LANE6 PL:ILLUMINA LB:LIB-MOM-1 SM:MOM PI:200
@RG ID:FLOWCELL1.LANE7 PL:ILLUMINA LB:LIB-MOM-2 SM:MOM PI:400
@RG ID:FLOWCELL1.LANE8 PL:ILLUMINA LB:LIB-MOM-2 SM:MOM PI:400
Kid's data:
@RG ID:FLOWCELL2.LANE1 PL:ILLUMINA LB:LIB-KID-1 SM:KID PI:200
@RG ID:FLOWCELL2.LANE2 PL:ILLUMINA LB:LIB-KID-1 SM:KID PI:200
@RG ID:FLOWCELL2.LANE3 PL:ILLUMINA LB:LIB-KID-2 SM:KID PI:400
@RG ID:FLOWCELL2.LANE4 PL:ILLUMINA LB:LIB-KID-2 SM:KID PI:400
Note the hierarchical relationship between read groups (unique for each lane) to libraries (sequenced on two lanes) and samples (across four lanes, two lanes for each library).
Use Picard's AddOrReplaceReadGroups tool to add read group information.
Picard contains a tool called ValidateSamFile that can be used for this. BAMs passing STRICT validation stringency work best with the GATK.
You can use the GATK to do the following:
GATK -I full.bam -T PrintReads -L chr1:10-20 -o subset.bam
and you'll get a BAM file containing only reads overlapping those points. This operation retains the complete BAM header from the full file (this was the reference aligned to, after all) so that the BAM remains easy to work with. We routinely use these features for testing and high-performance analysis with the GATK.
We support the Variant Call Format (VCF) for variant callsets. No other file formats are supported.
VCFTools contains a validation tool that will allow you to verify it.
No, we like VCF and we think it's important to have a good standard format. Multiplying formats just makes life hard for everyone, both developers and analysts.
We support three types of interval lists, as mentioned here. Interval lists should preferentially be formatted as Picard-style interval lists, with an explicit sequence dictionary, as this prevents accidental misuse (e.g. hg18 intervals on an hg19 file). Note that this file is 1-based, not 0-based (first position in the genome is position 1).
One relatively easy way to combine your intervals is to use the online tool Galaxy, using the Get Data -> Upload command to upload your intervals, and the Operate on Genomic Intervals command to compute the intersection or union of your intervals (depending on your needs).
Yes.
For more information, see the ExampleUnifiedGenotyper.scala or examples of using Scala's traits/mixins illustrated in the QScripts documentation.
In your QScript, define a var list and annotate it with @Argument. Initialize the value to Nil.
@Argument(doc="filter names", shortName="filter")
var filterNames: List[String] = Nil
On the command line specify the arguments by repeating the argument name.
-filter filter1 -filter filter2 -filter filter3
Then once your QScript is run, the command line arguments will be available for use in the QScript's script method.
def script {
var myCommand = new MyFunction
myCommand.filters = this.filterNames
}
For a full example of command line arguments see the QScripts documentation.
Wrap the utility with an InProcessFunction. If your functionality is reusable code you should add it to Sting Utils with Unit Tests and then invoke your new function from your InProcessFunction. Computationally or memory intensive functions should NOT be implemented as InProcessFunctions, and should be wrapped in Queue CommandLineFunctions instead.
class MySplitter extends InProcessFunction {
@Input(doc="inputs")
var in: File = _
@Output(doc="outputs")
var out: List[File] = Nil
def run {
StingUtilityMethod.quickSplitFile(in, out)
}
}
var splitter = new MySplitter
splitter.in = new File("input.txt")
splitter.out = List(new File("out1.txt"), new File("out2.txt"))
add(splitter)
See Queue CommandLineFunctions for more information on how @Input and @Output are used.
Create an instance of a ListWriterFunction and add it in your script method.
import org.broadinstitute.sting.queue.function.ListWriterFunction
</pre>
<pre>
val writeBamList = new ListWriterFunction
writeBamList.inputFiles = bamFiles
writeBamList.listFile = new File("myBams.list")
add(writeBamList)
Queue contains a trait mixin you can use to add Log4J support to your classes.
Add the import for the trait Logging to your QScript.
import org.broadinstitute.sting.queue.util.Logging
Mixin the trait to your class.
class MyScript extends Logging {
...
Then use the mixed in logger to write debug output when the user specifies -l DEBUG.
logger.debug("This will only be displayed when debugging is enabled.")
Try ant clean.
Queue relies on a lot of Scala traits / mixins. These dependencies are not always picked up by the scala/java compilers leading to partially implemented classes. If that doesn't work please let us know in the forum.
No. QScript will create all parent directories for outputs.
Queue's LSF dispatcher automatically looks up and sets the maximum runtime for whichever LSF queue is specified. If you set your -jobQueue/.jobQueue to hour then you should see something like this under bjobs -l:
RUNLIMIT
240.0 min of gsa3
Queue GridEngine functionality is community supported. See here for full details: Queue with Grid Engine.
The easiest way to do this at the moment is to mixin a trait.
First define a trait which adds your java options:
trait RemoteDebugging extends JavaCommandLineFunction {
override def javaOpts = super.javaOpts + " -Xdebug -Xrunjdwp:transport=dt_socket,server=y,suspend=n,address=5005"
}
Then mix in the trait to your walker and otherwise run it as normal:
val printReadsDebug = new PrintReads with RemoteDebugging
printReadsDebug.reference_sequence = "my.fasta"
// continue setting up your walker...
add(printReadsDebug)
If you see something like the following, it means that Queue believes that it previously successfully generated all of the outputs.
INFO 16:25:55,049 QCommandLine - Scripting ExampleUnifiedGenotyper
INFO 16:25:55,140 QCommandLine - Added 4 functions
INFO 16:25:55,140 QGraph - Generating graph.
INFO 16:25:55,164 QGraph - Generating scatter gather jobs.
INFO 16:25:55,714 QGraph - Removing original jobs.
INFO 16:25:55,716 QGraph - Adding scatter gather jobs.
INFO 16:25:55,779 QGraph - Regenerating graph.
INFO 16:25:55,790 QGraph - Running jobs.
INFO 16:25:55,853 QGraph - 0 Pend, 0 Run, 0 Fail, 10 Done
INFO 16:25:55,902 QCommandLine - Done
Queue will not re-run the job if a .done file is found for the all the outputs, e.g.: /path/to/.output.file.done. You can either remove the specific .done files yourself, or use the -startFromScratch command line option.
Scala is a combination of an object oriented framework and a functional programming language. For a good introduction see the free online book Programming Scala.
The following are extremely brief answers to frequently asked questions about Scala which often pop up when first viewing or editing QScripts. For more information on Scala there a multitude of resources available around the web including the Scala home page and the online Scala Doc.
var and val?var is a value you can later modify, while val is similar to final in Java.
Because the GATK and Queue are a mix of Scala and Java sometimes you'll run into problems when you need a Scala collection and instead a Java collection is returned.
MyQScript.scala:39: error: type mismatch;
found : java.util.List[java.lang.String]
required: scala.List[String]
val wrapped: List[String] = TextFormattingUtils.wordWrap(text, width)
Use the implicit definitions in JavaConversions to automatically convert the basic Java collections to and from Scala collections.
import collection.JavaConversions._
Scala has a very rich collections framework which you should take the time to enjoy. One of the first things you'll notice is that the default Scala collections are immutable, which means you should treat them as you would a String. When you want to 'modify' an immutable collection you need to capture the result of the operation, often assigning the result back to the original variable.
var str = "A"
str + "B"
println(str) // prints: A
str += "C"
println(str) // prints: AC
var set = Set("A")
set + "B"
println(set) // prints: Set(A)
set += "C"
println(set) // prints: Set(A, C)
Use the :+ operator for a single value.
var myList = List.empty[String]
myList :+= "a"
myList :+= "b"
myList :+= "c"
Use ++ for appending a list.
var myList = List.empty[String]
myList ++= List("a", "b", "c")
Use the + operator.
var mySet = Set.empty[String]
mySet += "a"
mySet += "b"
mySet += "c"
Use the + and -> operators.
var myMap = Map.empty[String,Int]
myMap += "a" -> 1
myMap += "b" -> 2
myMap += "c" -> 3
Option is a Scala generic type that can either be some generic value or None. Queue often uses it to represent primitives that may be null.
var myNullableInt1: Option[Int] = Some(1)
var myNullableInt2: Option[Int] = None
François Armand's slide deck is a good introduction: http://www.slideshare.net/normation/scala-dreaded
To quote from his slides:
Give me a variable name but
- I don't care of what it is
- and/or
- don't want to pollute my namespace with it
Use the .format() method.
This Java snippet:
String formatted = String.format("%s %i", myString, myInt);
In Scala would be:
val formatted = "%s %i".format(myString, myInt)
No. Currently Scala's Enumeration class does not interact with the Java reflection API in a way that could be used for Queue command line arguments. You can use Java enums if for example you are importing a Java based walker's enum type.
If/when we find a workaround for Queue we'll update this entry. In the meantime try using a String.
Yes. Be sure to install the scala plugin and setup your IDE as listed in [Queue with IntelliJ IDEA(http://gatkforums.broadinstitute.org/discussion/1309/queue-with-intellij-idea).
Check if there is an update to your Scala plugin as well.
Check your IntelliJ IDEA settings to for the following:
File Types have *.scala as a registered pattern for Scala files.The variant quality score recalibrator builds an adaptive error model using known variant sites and then applies this model to estimate the probability that each variant is a true genetic variant or a machine artifact. VQSR must be run twice in succession in order to build a separate error model for SNPs and INDELs. One major improvement from previous recommended protocols is that hand filters do not need to be applied at any point in the process now. All filtering criteria are learned from the data itself.
java -Xmx4g -jar GenomeAnalysisTK.jar \ -T VariantRecalibrator \ -R path/to/reference/human_g1k_v37.fasta \ -input raw.input.vcf \ -recalFile path/to/output.recal \ -tranchesFile path/to/output.tranches \ -nt 4 \ [SPECIFY TRUTH AND TRAINING SETS] \ [SPECIFY WHICH ANNOTATIONS TO USE IN MODELING] \ [SPECIFY WHICH CLASS OF VARIATION TO MODEL] \
For SNPs we use both HapMap v3.3 and the Omni chip array from the 1000 Genomes Project as training data. In addition we take the highest confidence SNPs from the project's callset. These datasets are available in the GATK resource bundle. Arguments for VariantRecalibrator command:
-percentBad 0.01 -minNumBad 1000 \ -resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.b37.sites.vcf \ -resource:omni,known=false,training=true,truth=true,prior=12.0 1000G_omni2.5.b37.sites.vcf \ -resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.high_confidence.vcf \ -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp.b37.vcf \ -an QD -an MQRankSum -an ReadPosRankSum -an FS -an DP \ -mode SNP \
Note that, for the above to work, the input vcf needs to be annotated with the corresponding values (QD, FS, DP, etc.). If any of these values are somehow missing, then VariantAnnotator needs to be run first so that VariantRecalibration can run properly.
Also, using the provided sites-only truth data files is important here as parsing the genotypes for VCF files with many samples increases the runtime of the tool significantly.
Some of these annotations might not be the best for your particular dataset. For example, InbreedingCoeff is a population level statistic that requires at least 10 samples in order to be calculated. If your study design has more than 10 samples then it is recommended to be included.
Depth of coverage (the DP annotation invoked by Coverage) should not be used when working with hybrid capture datasets since there is extreme variation in the depth to which targets are captured! In whole genome experiments this variation is indicative of error but that is not the case in capture experiments.
Additionally, the UnifiedGenotyper produces a statistic called the HaplotypeScore which should be used for SNPs. This statistic isn't necessary for the HaplotypeCaller because that mathematics is already built into the likelihood function itself when calling full haplotypes.
In our testing we've found that in order to achieve the best exome results one needs to use an exome SNP and/or indel callset with at least 30 samples. For users with experiments containing fewer exome samples there are several options to explore:
When modeling indels with the VQSR we use a training dataset that was created at the Broad by strictly curating the (Mills, Devine, Genome Research, 2011) dataset as as well as adding in very high confidence indels from the 1000 Genomes Project. This dataset is available in the GATK resource bundle. Arguments for VariantRecalibrator:
--maxGaussians 4 -percentBad 0.01 -minNumBad 1000 \ -resource:mills,known=false,training=true,truth=true,prior=12.0 Mills_and_1000G_gold_standard.indels.b37.sites.vcf \ -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp.b37.vcf \ -an DP -an FS -an ReadPosRankSum -an MQRankSum \ -mode INDEL \
Note that indels use a different set of annotations than SNPs. Most annotations related to mapping quality have been removed since there is a conflation with the length of an indel in a read and the degradation in mapping quality that is assigned to the read by the aligner. This covariation is not necessarily indicative of being an error in the same way that it is for SNPs.
InbreedingCoeff is a population level statistic that requires at least 10 samples in order to be calculated. If your study design has more than 10 samples then it is recommended to be included.
The power of the VQSR is that it assigns a calibrated probability to every putative mutation in the callset. The user is then able to decide at what point on the theoretical ROC curve their project wants to live. Some projects, for example, are interested in finding every possible mutation and can tolerate a higher false positive rate. On the other hand, some projects want to generate a ranked list of mutations that they are very certain are real and well supported by the underlying data. The VQSR provides the necessary statistical machinery to effectively apply this sensitivity/specificity tradeoff.
java -Xmx3g -jar GenomeAnalysisTK.jar \ -T ApplyRecalibration \ -R reference/human_g1k_v37.fasta \ -input raw.input.vcf \ -tranchesFile path/to/input.tranches \ -recalFile path/to/input.recal \ -o path/to/output.recalibrated.filtered.vcf \ [SPECIFY THE DESIRED LEVEL OF SENSITIVITY TO TRUTH SITES] \ [SPECIFY WHICH CLASS OF VARIATION WAS MODELED] \
For SNPs we used HapMap 3.3 and the Omni 2.5M chip as our truth set. The default recommendation is to achieve 99.9% sensitivity to the accessible truth sites. Naturally projects involving a higher degree of diversity in terms of world populations can expect to achieve a higher truth sensitivity.
--ts_filter_level 99.9 \ -mode SNP \
For indels we use the Mills / 1000 Genomes indel truth set described above. The default recommendation is to achieve 99.9% sensitivity to the accessible truth sites. Naturally projects involving a higher degree of diversity in terms of world populations can expect to achieve a higher truth sensitivity.
--ts_filter_level 99.9 \ -mode INDEL \
JEXL stands for Java EXpression Language. It's not a part of the GATK as such; it's a software library that can be used by Java-based programs like the GATK. It can be used for many things, but in the context of the GATK, it has one very specific use: making it possible to operate on subsets of variants from VCF files based on one or more annotations, using a single command. This is typically done with walkers such as VariantFiltration and SelectVariants.
In this context, a JEXL expression is a string (in the computing sense, i.e. a series of characters) that tells the GATK which annotations to look at and what selection rules to apply.
JEXL expressions contain three basic components: keys and values, connected by operators. For example, in this simple JEXL expression which selects variants whose quality score is greater than 30:
"QUAL > 30.0"
QUAL is a key: the name of the annotation we want to look at30.0 is a value: the threshold that we want to use to evaluate variant quality against> is an operator: it determines which "side" of the threshold we want to selectThe complete expression must be framed by double quotes. Within this, keys are strings (typically written in uppercase or CamelCase), and values can be either strings, numbers or booleans (TRUE or FALSE) -- but if they are strings the values must be framed by single quotes, as in the following example:
"MY_STRING_KEY == 'foo'"
You can build expressions that calculate a metric based on two separate annotations, for example if you want to select variants for which quality (QUAL) divided by depth of coverage (DP) is below a certain threshold value:
"QUAL / DP < 10.0"
You can also join multiple conditional statements with logical operators, for example if you want to select variants that have both sufficient quality (QUAL) and a certain depth of coverage (DP):
"QUAL > 30.0 && DP == 10"
where && is the logical "AND".
Or if you want to select variants that have at least one of several conditions fulfilled:
"QD < 2.0 || ReadPosRankSum < -20.0 || FS > 200.0"
where || is the logical "OR".
It is very important to note that the JEXL evaluation subprogram cannot correctly handle cases where the annotations requested by the JEXL expression are missing for some variants in a VCF record. It will throw an exception (i.e. fail with an error) when it encounters this scenario. The default behavior of the GATK is to handle this by having the entire expression evaluate to FALSE in such cases (although some tools provide options to change this behavior). This is extremely important especially when constructing complex expressions, because it affects how you should interpret the result.
For example, looking again at that last expression:
"QD < 2.0 || ReadPosRankSum < -20.0 || FS > 200.0"
When run against a VCF record with INFO field
QD=10.0;FS=300.0;ReadPosRankSum=-10.0
it will evaluate to TRUE because the FS value is greater than 200.0.
But when run against a VCF record with INFO field
QD=10.0;FS=300.0
it will evaluate to FALSE because there is no ReadPosRankSum value defined at all and JEXL fails to evaluate it.
This means that when you're trying to filter out records with VariantFiltration, for example, the previous record would be marked as PASSing, even though it contains a bad FS value.
For this reason, we highly recommend that complex expressions involving OR operations be split up into separate expressions whenever possible. For example, the previous example would have 3 distinct expressions: "QD < 2.0", "ReadPosRankSum < -20.0", and "FS > 200.0". This way, although the ReadPosRankSum expression evaluates to FALSE when the annotation is missing, the record can still get filtered (again using the example of VariantFiltration) when the FS value is greater than 200.0.
Currently, VCF INFO field keys are case-sensitive. That means that if you have a QUAL field in uppercase in your VCF record, the system will not recognize it if you write it differently (Qual, qual or whatever) in your JEXL expression.
The types (i.e. string, integer, non-integer or boolean) used in your expression must be exactly the same as that of the value you are trying to evaluate. In other words, if you have a QUAL field with non-integer values (e.g. 45.3) and your filter expression is written as an integer (e.g. "QUAL < 50"), the system will throw a hissy fit (aka a Java exception).
Note that this last part is fairly advanced and not for the faint of heart. To be frank, it's also explained rather more briefly than the topic deserves. But if there's enough demand for this level of usage (click the "view in forum" link and leave a comment) we'll consider producing a full-length tutorial.
If you are familiar with the VariantContext, Genotype and its associated classes and methods, you can directly access the full range of capabilities of the underlying objects from the command line. The underlying VariantContext object is available through the vc variable.
For example, suppose I want to use SelectVariants to select all of the sites where sample NA12878 is homozygous-reference. This can be accomplished by assessing the underlying VariantContext as follows:
java -Xmx4g -jar GenomeAnalysisTK.jar -T SelectVariants -R b37/human_g1k_v37.fasta --variant my.vcf -select 'vc.getGenotype("NA12878").isHomRef()'
Groovy, right? Now here's a more sophisticated example of JEXL expression that finds all novel variants in the total set with allele frequency > 0.25 but not 1, is not filtered, and is non-reference in 01-0263 sample:
! vc.getGenotype("01-0263").isHomRef() && (vc.getID() == null || vc.getID().equals(".")) && AF > 0.25 && AF < 1.0 && vc.isNotFiltered() && vc.isSNP() -o 01-0263.high_freq_novels.vcf -sn 01-0263
The classic way of evaluating a boolean goes like this:
java -Xmx4g -jar GenomeAnalysisTK.jar -T SelectVariants -R b37/human_g1k_v37.fasta --variant my.vcf -select 'DB'
But you can also use the VariantContext object like this:
java -Xmx4g -jar GenomeAnalysisTK.jar -T SelectVariants -R b37/human_g1k_v37.fasta --variant my.vcf -select 'vc.hasAttribute("DB")'
Sometimes you might want to write a JEXL expression to evaluate e.g. the AD (allelic depth) field in the FORMAT column. However, the AD is technically not an integer; rather it is a list (array) of integers. One can evaluate the array data using the "." operator. Here's an example:
java -Xmx4g -jar GenomeAnalysisTK.jar -T SelectVariants -R b37/human_g1k_v37.fasta --variant my.vcf -select 'vc.getGenotype("NA12878").getAD().0 > 10'
You probably know by now that GATK-Lite is a free-for-everyone and completely open-source version of the GATK (licensed under the original MIT license).
But what's in the box? What can GATK-Lite do -- or rather, what can it not do that the full version (let's call it GATK-Full) can? And what does that mean exactly, in terms of functionality, reliability and power?
To really understand the differences between GATK-Lite and GATK-Full, you need some more information on how the GATK works, and how we work to develop and improve it.
As explained here, the engine handles all the common work that's related to data access, conversion and traversal, as well as high-performance computing features. The engine is supported by an infrastructure of software libraries. If the GATK was a car, that would be the engine and chassis. What we call the **tools* are attached on top of that, and they provide the various analytical and processing functionalities like variant calling and base or variant recalibration. On your car, that would be headlights, airbags and so on.
We do all our development work on a single codebase. This means that everything --the engine and all tools-- is on one common workbench. There are not different versions that we work on in parallel -- that would be crazy to manage! That's why the version numbers of GATK-Lite and GATK-Full always match: if the latest GATK-Full version is numbered 2.1-13, then the latest GATK-Lite is also numbered 2.1-13.
The most important consequence of this setup is that when we make improvements to the infrastructure and engine, the same improvements will end up in GATK Lite and in GATK Full. So for the purposes of power, speed and robustness of the GATK that is determined by the engine, there is no difference between them.
For the tools, it's a little more complicated -- but not much. When we "build" the GATK binaries (the .jar files), we put everything from the workbench into the Full build, but we only put a subset into the Lite build. Note that this Lite subset is pretty big -- it contains all the tools that were previously available in GATK 1.x versions, and always will. We also reserve the right to add previews or not-fully-featured versions of the new tools that are in Full, at our discretion, to the Lite build.
We have a new tool that performs a brand new function (which wasn't available in GATK 1.x), and we only include it in the Full build.
We have a tool that has some new add-on capabilities (which weren't possible in GATK 1.x); we put the tool in both the Lite and the Full build, but the add-ons are only available in the Full build.
Reprising the car analogy, GATK-Lite and GATK-Full are like two versions of the same car -- the basic version and the fully-equipped one. They both have the exact same engine, and most of the equipment (tools) is the same -- for example, they both have the same airbag system, and they both have headlights. But there are a few important differences:
The GATK-Full car comes with a GPS (sat-nav for our UK friends), for which the Lite car has no equivalent. You could buy a portable GPS unit from a third-party store for your Lite car, but it might not be as good, and certainly not as convenient, as the Full car's built-in one.
Both cars have windows of course, but the Full car has power windows, while the Lite car doesn't. The Lite windows can open and close, but you have to operate them by hand, which is much slower.
The underlying engine is exactly the same in both GATK-Lite and GATK-Full. Most functionalities are available in both builds, performed by the same tools. Some functionalities are available in both builds, but they are performed by different tools, and the tool in the Full build is better. New, cutting-edge functionalities are only available in the Full build, and there is no equivalent in the Lite build.
We hope this clears up some of the confusion surrounding GATK-Lite. If not, please leave a comment and we'll do our best to clarify further!
Just because something looks like a SNP in IGV doesn't mean that it is of high quality. We are extremely confident in the genotype likelihoods calculations in the Unified Genotyper (especially for SNPs), so before you post this issue in our support forum you will first need to do a little investigation on your own.
To diagnose what is happening, you should take a look at the pileup of bases at the position in question. It is very important for you to look at the underlying data here.
Here is a checklist of questions you should ask yourself:
The genotyper ignores sites if there are too many overlapping deletions. This value can be set using the --max_deletion_fraction argument (see the UG's documentation page to find out what is the default value for this argument), but be aware that increasing it could affect the reliability of your results.
Remember that there is a minimum base quality threshold and that low base qualities mean that the sequencer assigned a low confidence to that base. If your would-be SNP is only supported by low-confidence bases, it is probably a false positive.
Keep in mind that the depth reported in the VCF is the unfiltered depth. You may think you have good coverage at that site, but the Unified Genotyper ignores bases if they don't look good, so actual coverage seen by the UG may be lower than you think.
A base's quality is capped by the mapping quality of its read. The reason for this is that low mapping qualities mean that the aligner had little confidence that the read is mapped to the correct location in the genome. You may be seeing mismatches because the read doesn't belong there -- you may be looking at the sequence of some other locus in the genome!
Keep in mind also that reads with mapping quality 255 ("unknown") are ignored.
By default the UG will only consider a certain number of alternate alleles. This value can be set using the --max_alternate_alleles argument (see the UG's documentation page to find out what is the default value for this argument). Note however that genotyping sites with many alternate alleles is both CPU and memory intensive and it scales exponentially based on the number of alternate alleles. Unless there is a good reason to change the default value, we highly recommend that you not play around with this parameter.
SOLiD alignments tend to have reference bias and it can be severe in some cases. Do the SOLiD reads have a lot of mismatches (no-calls count as mismatches) around the the site? If so, you are probably seeing false positives.