Tagged with #error
0 documentation articles | 0 announcements | 24 forum discussions


No posts found with the requested search criteria.
No posts found with the requested search criteria.
Comments (6)

Hello All,

I am running RealignerTargetCreator using GATK version GenomeAnalysisTK-1.2-4-gd9ea764 and I am getting the following error: `

ERROR MESSAGE: Input files reads and reference have incompatible contigs: Found contigs with the same name but different lengths:
ERROR contig reads = scaffold69676_size1796 / 3149
ERROR contig reference = scaffold69676_size1796 / 1758.
ERROR reads contigs = [scaffold1_size320545, scaffold2_size291774, scaffold3_size284740..........`

I already checked that I am using the right Reference FASTA file and the correct .bam file, that I have used for alignment before. Therefore, I am clueless why I am getting this error? I would appreciate your help regarding this problem. Any suggestion is welcome?

Thanks, Namrata

Comments (2)

I am analyzing ION PGM data

i'm getting 25 variants in one individual with the HaplotypeCaller i try to run the VariantRecalibrator, but i get this error

WARN 18:26:10,578 VariantDataManager - WARNING: Training with very few variant sites! Please check the model reporting PDF to ensure the quality of the model is reliable. INFO 18:26:10,580 GaussianMixtureModel - Initializing model with 100 k-means iterations... INFO 18:26:10,636 VariantRecalibratorEngine - Finished iteration 0. INFO 18:26:10,639 VariantRecalibratorEngine - Convergence after 3 iterations! INFO 18:26:10,640 VariantDataManager - Training with worst 0 scoring variants --> variants with LOD <= -5.0000. INFO 18:26:11,854 ProgressMeter - chrM:14784 8.87e+06 30.0 s 3.0 s 100.0% 30.0 s 0.0 s INFO 18:26:12,444 GATKRunReport - Uploaded run statistics report to AWS S3

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.IllegalArgumentException: No data found. at org.broadinstitute.sting.gatk.walkers.variantrecalibration.VariantRecalibratorEngine.generateModel(VariantRecalibratorEngine.java:83) at org.broadinstitute.sting.gatk.walkers.variantrecalibration.VariantRecalibrator.onTraversalDone(VariantRecalibrator.java:392) at org.broadinstitute.sting.gatk.walkers.variantrecalibration.VariantRecalibrator.onTraversalDone(VariantRecalibrator.java:138) at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129) at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:116) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:313) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:121) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:248) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:155) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:107)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 3.1-1-g07a4bf8):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: No data found.
ERROR ------------------------------------------------------------------------------------------

the command line i use was

java -jar /home/horus/Instaladores/GenomeAnalysisTK-3.1-1/GenomeAnalysisTK.jar -T VariantRecalibrator -R /home/horus/Escritorio/PGM/primirna/references/hg19usar.fa -input 1_raw_variants.vcf -resource:hapmap,known=false,training=true,truth=true,prior=15.0 /home/horus/Escritorio/PGM/primirna/references/hapmap_3.3.b37.vcf_nuevo -resource:omni,known=false,training=true,truth=true,prior=12.0 /home/horus/Escritorio/PGM/primirna/references/1000G_omni2.5.b37.vcf_nuevo -resource:1000G,known=false,training=true,truth=false,prior=10.0 /home/horus/Escritorio/PGM/primirna/references/Mills_and_1000G_gold_standard.indels.b37.vcf_nuevo -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 /home/horus/Escritorio/PGM/primirna/references/dbsnp_138.hg19.vcf -an DP -an QD -an FS -an MQRankSum -an ReadPosRankSum -mode SNP -tranche 100.0 -tranche 99.9 -tranche 99.0 -tranche 90.0 -recalFile 1_recalibrate_SNP.recal -tranchesFile 1_recalibrate_SNP.tranches

Comments (3)

Here is my error .. I lauch the same command on 3 svg generated by the same UnifiedGenotyper commen ..

thx!

`java -Djava.io.tmpdir=/scratch/ymb-542-aa/temp -Xmx22g -jar /rap/ymb-542-aa/utils/tools/dna_tools/post_alignment_tools/GenomeAnalysisTK-2.8-1/GenomeAnalysisTK.jar -nt 8 -et NO_ET -K /rap/ymb-542-aa/utils/tools/dna_tools/post_alignment_tools/GenomeAnalysisTK-2.8-1/raphael.poujol_umontreal.ca.key -T VariantRecalibrator -R /scratch/ymb-542-aa/pancreas/Genomes/hg19.fa -input /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf -mode SNP -resource:hapmap,known=false,training=true,truth=true,prior=15.0 /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf -resource:omni,known=false,training=true,truth=false,prior=10.0 /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf -an QD -an DP -an FS -an MQ -tranche 100.0 -tranche 99.9 -tranche 99.0 -tranche 90.0
-recalFile /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.snps.recal -tranchesFile /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.snps.tranches -rscriptFile /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.snps.plots.RINFO 20:41:18,337 HelpFormatter - -------------------------------------------------------------------------------- INFO 20:41:18,338 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.8-1-g932cd3a, Compiled 2013/12/06 16:47:15 INFO 20:41:18,339 HelpFormatter - Copyright (c) 2010 The Broad Institute INFO 20:41:18,339 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk INFO 20:41:18,342 HelpFormatter - Program Args: -nt 8 -et NO_ET -K /rap/ymb-542-aa/utils/tools/dna_tools/post_alignment_tools/GenomeAnalysisTK-2.8-1/raphael.poujol_umontreal.ca.key -T VariantRecalibrator -R /scratch/ymb-542-aa/pancreas/Genomes/hg19.fa -input /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf -mode SNP -resource:hapmap,known=false,training=true,truth=true,prior=15.0 /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf -resource:omni,known=false,training=true,truth=false,prior=10.0 /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf -an QD -an DP -an FS -an MQ -tranche 100.0 -tranche 99.9 -tranche 99.0 -tranche 90.0 -recalFile /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.snps.recal -tranchesFile /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.snps.tranches -rscriptFile /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.snps.plots.R INFO 20:41:18,342 HelpFormatter - Date/Time: 2014/03/18 20:41:18 INFO 20:41:18,342 HelpFormatter - -------------------------------------------------------------------------------- INFO 20:41:18,342 HelpFormatter - -------------------------------------------------------------------------------- INFO 20:41:18,367 ArgumentTypeDescriptor - Dynamically determined type of /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf to be VCF INFO 20:41:18,395 ArgumentTypeDescriptor - Dynamically determined type of /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf to be VCF INFO 20:41:18,400 ArgumentTypeDescriptor - Dynamically determined type of /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf to be VCF INFO 20:41:18,404 ArgumentTypeDescriptor - Dynamically determined type of /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf to be VCF INFO 20:41:19,154 GenomeAnalysisEngine - Strictness is SILENT INFO 20:41:19,258 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 1000 INFO 20:41:19,313 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,346 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:19,447 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:19,473 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:19,561 MicroScheduler - Running the GATK in parallel mode with 8 total threads, 1 CPU thread(s) for each of 8 data thread(s), of 8 processors available on this machine INFO 20:41:19,608 GenomeAnalysisEngine - Preparing for traversal INFO 20:41:19,622 GenomeAnalysisEngine - Done preparing for traversal
INFO 20:41:19,622 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING] INFO 20:41:19,622 ProgressMeter - Location processed.sites runtime per.1M.sites completed total.runtime remaining WARN 20:41:19,637 Utils - ******************************************************************************** WARN 20:41:19,637 Utils - * WARNING: WARN 20:41:19,637 Utils - * WARN 20:41:19,637 Utils - * Rscript not found in environment path. WARN 20:41:19,637 Utils - * /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.snps.plots.R will be WARN 20:41:19,637 Utils - * generated but PDF plots will not. WARN 20:41:19,637 Utils - ******************************************************************************** INFO 20:41:19,640 TrainingSet - Found hapmap track: Known = false Training = true Truth = true Prior = Q15.0 INFO 20:41:19,640 TrainingSet - Found omni track: Known = false Training = true Truth = false Prior = Q10.0 INFO 20:41:19,641 TrainingSet - Found dbsnp track: Known = true Training = false Truth = false Prior = Q2.0 INFO 20:41:19,698 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,705 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,713 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:19,722 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,726 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:19,736 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,739 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:19,747 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,751 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:19,760 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,763 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:19,772 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Calling/sub1_focus.haplo.vcf INFO 20:41:19,775 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:19,845 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:19,856 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:19,932 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:19,947 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:21,428 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:21,437 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:21,492 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/hapmap_3.3.hg19.vcf INFO 20:41:21,503 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:21,514 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:21,526 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:21,538 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:21,593 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/1000G_omni2.5.hg19.vcf INFO 20:41:21,605 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:21,667 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:21,859 RMDTrackBuilder - Loading Tribble index from disk for file /scratch/ymb-542-aa/pancreas/Genomes/dbsnp_138.hg19_noXY.vcf INFO 20:41:49,625 ProgressMeter - chr6:33023946 2.48e+07 30.0 s 1.0 s 34.9% 85.0 s 55.0 s INFO 20:42:19,626 ProgressMeter - chr14:38996406 5.30e+07 60.0 s 1.0 s 76.3% 78.0 s 18.0 s INFO 20:42:36,649 VariantDataManager - QD: mean = 16.83 standard deviation = 7.62 INFO 20:42:36,653 VariantDataManager - DP: mean = 19.65 standard deviation = 12.45 INFO 20:42:36,658 VariantDataManager - FS: mean = 0.41 standard deviation = 1.14 INFO 20:42:36,660 VariantDataManager - MQ: mean = 40.98 standard deviation = 2.71 INFO 20:42:36,718 VariantDataManager - Annotations are now ordered by their information content: [MQ, DP, QD, FS] INFO 20:42:36,720 VariantDataManager - Training with 5929 variants after standard deviation thresholding. INFO 20:42:36,729 GaussianMixtureModel - Initializing model with 100 k-means iterations... INFO 20:42:37,020 VariantRecalibratorEngine - Finished iteration 0. INFO 20:42:37,163 VariantRecalibratorEngine - Finished iteration 5. Current change in mixture coefficients = 0.32548 INFO 20:42:37,262 VariantRecalibratorEngine - Finished iteration 10. Current change in mixture coefficients = 0.40180 INFO 20:42:37,360 VariantRecalibratorEngine - Finished iteration 15. Current change in mixture coefficients = 0.24424 INFO 20:42:37,459 VariantRecalibratorEngine - Finished iteration 20. Current change in mixture coefficients = 0.30560 INFO 20:42:37,557 VariantRecalibratorEngine - Finished iteration 25. Current change in mixture coefficients = 0.07436 INFO 20:42:37,655 VariantRecalibratorEngine - Finished iteration 30. Current change in mixture coefficients = 0.02595 INFO 20:42:37,753 VariantRecalibratorEngine - Finished iteration 35. Current change in mixture coefficients = 0.01395 INFO 20:42:37,851 VariantRecalibratorEngine - Finished iteration 40. Current change in mixture coefficients = 0.01163 INFO 20:42:37,948 VariantRecalibratorEngine - Finished iteration 45. Current change in mixture coefficients = 0.01117 INFO 20:42:38,046 VariantRecalibratorEngine - Finished iteration 50. Current change in mixture coefficients = 0.02233 INFO 20:42:38,144 VariantRecalibratorEngine - Finished iteration 55. Current change in mixture coefficients = 0.01832 INFO 20:42:38,242 VariantRecalibratorEngine - Finished iteration 60. Current change in mixture coefficients = 0.01221 INFO 20:42:38,340 VariantRecalibratorEngine - Finished iteration 65. Current change in mixture coefficients = 0.01370 INFO 20:42:38,438 VariantRecalibratorEngine - Finished iteration 70. Current change in mixture coefficients = 0.04717 INFO 20:42:38,536 VariantRecalibratorEngine - Finished iteration 75. Current change in mixture coefficients = 0.01022 INFO 20:42:38,634 VariantRecalibratorEngine - Finished iteration 80. Current change in mixture coefficients = 0.00365 INFO 20:42:38,731 VariantRecalibratorEngine - Finished iteration 85. Current change in mixture coefficients = 0.00875 INFO 20:42:38,829 VariantRecalibratorEngine - Finished iteration 90. Current change in mixture coefficients = 0.00391 INFO 20:42:38,927 VariantRecalibratorEngine - Finished iteration 95. Current change in mixture coefficients = 0.00411 INFO 20:42:39,005 VariantRecalibratorEngine - Convergence after 99 iterations! INFO 20:42:39,037 VariantRecalibratorEngine - Evaluating full set of 12403 variants... INFO 20:42:39,038 VariantDataManager - Training with worst 0 scoring variants --> variants with LOD <= -5.0000.

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

org.broadinstitute.sting.utils.exceptions.ReviewedStingException: Unable to retrieve result at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.execute(HierarchicalMicroScheduler.java:190) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:313) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:91) Caused by: java.lang.NullPointerException at org.broadinstitute.sting.gatk.walkers.variantrecalibration.VariantRecalibratorEngine.generateModel(VariantRecalibratorEngine.java:83) at org.broadinstitute.sting.gatk.walkers.variantrecalibration.VariantRecalibrator.onTraversalDone(VariantRecalibrator.java:359) at org.broadinstitute.sting.gatk.walkers.variantrecalibration.VariantRecalibrator.onTraversalDone(VariantRecalibrator.java:139) at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.notifyTraversalDone(HierarchicalMicroScheduler.java:226) at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.execute(HierarchicalMicroScheduler.java:183) ... 5 more

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.8-1-g932cd3a):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Unable to retrieve result
ERROR ------------------------------------------------------------------------------------------

`

Comments (6)

Hi,

I was trying to call variants in RNAseq data using GATK 3.0 when I got the following stack trace:

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
java.lang.NullPointerException
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.PairHMMLikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(PairHMMLikelihoodCalculationEngine.java:421)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.PairHMMLikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(PairHMMLikelihoodCalculationEngine.java:395)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.GenotypingEngine.calculateGLsForThisEvent(GenotypingEngine.java:385)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.GenotypingEngine.assignGenotypeLikelihoods(GenotypingEngine.java:222)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:872)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:141)
        at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions$TraverseActiveRegionMap.apply(TraverseActiveRegions.java:708)
        at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions$TraverseActiveRegionMap.apply(TraverseActiveRegions.java:704)
        at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler$ReadMapReduceJob.run(NanoScheduler.java:471)
        at java.util.concurrent.Executors$RunnableAdapter.call(Executors.java:471)
        at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:334)
        at java.util.concurrent.FutureTask.run(FutureTask.java:166)
        at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
        at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
        at java.lang.Thread.run(Thread.java:724)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version nightly-2014-03-10-gf78001a):
##### ERROR
##### ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
##### ERROR If not, please post the error message, with stack trace, to the GATK forum.
##### ERROR Visit our website and forum for extensive documentation and answers to 
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: Code exception (see stack trace for error itself)
##### ERROR ------------------------------------------------------------------------------------------

Here are the command line arguments:

Program Args: -T HaplotypeCaller -I in.bam -R ref.fa -o raw.snps.indels.vcf -nct 8 -recoverDanglingHeads -dontUseSoftClippedBases -stand_call_conf 20 -stand_emit_conf 20

As you can see, I got the error above from one of the nightly builds. Before that I also tried version 3.0-0-g6bad1c6, and this produced the exact same error. What's curious about this is that it didn't fail in the same place each time. I did this on 20 samples, and for the first run, 15 of the samples failed with this error. One of the samples failed after 7 minutes, so I decided to try that one again to see if I could reproduce it, but it went past the point (both in time and genomic position) where it failed the first time.

I decided to download a nightly build (version nightly-2014-03-10-gf78001a) and see if this had been fixed, but again, 15 of the samples failed. However, it was not the same set of samples that failed as with the other version.

The reads were aligned using STAR, and prior to this step I ran SplitNCigarReads and IndelRealigner.

Thanks, Niklas

Comments (19)

Hi,

I'm now at the VQSR step of the best practices and to my surprise I got the following error related to java (I think):

Error: Could not find or load main class –jar

Here is my command line:

java –jar GenomeAnalysisTK.jar –T VariantRecalibrator –R ../human_g1k_v37.fasta –input ../raw_variants.vcf -resource:hapmap,known=false,training=true,truth=true,prior=15.0 ../hapmap_3.3.b37.vcf -resource:omni,known=false,training=true,truth=false,prior=12.0 ../1000G_omni2.5.b37.vcf -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 ../dbsnp_138.b37.vcf -resource:1000G,known=false,training=true,truth=false,prior=10.0 ../1000G_phase1.snps.high_confidence.b37.vcf -an QD -an MQRankSum -an ReadPosRankSum -an FS --maxGaussians 4 –mode SNP -tranche 100.0 -tranche 99.9 -tranche 99.0 -tranche 90.0 –recalFile raw.SNPs.recal –tranchesFile raw.SNPs.tranches -rscriptFile recal.plots.R

I don't understand what is the problem. Could someone look at it and identify if I made a mistake in my command line?

Thank you for your support

Comments (1)

Hi All We are running into some random weirdness when running jobs using SGE, GATK version 2.7-2-g6bda569, pretty much all GATK tools - but mostly IndelRealigner abd UnifiedGenotyper, we often get the following error:-

ERROR MESSAGE: Couldn't read file /scratch/project/pipelines/novorecal.bam because java.io.FileNotFoundException: /scratch/project/pipelines/novorecal.bam (No such file or directory)

This also happens for supplied reference genomes and vcf files. The GATK tool cant find them.

These "missing" files do exist, and have often even been created by the previous tool/step in the pipeline.

When we re-run the pipeline on a failed sample, it works. So we end up having to re-run our pipeline on the same set of samples multiple times and are beginning to find this very frustrating. These errors seem to be random, I cant find any pattern, and as I mentioned, when we re-run the pipeline on a failed run, it work without a hitch.

Has anyone experienced this? And if so, any recommendations?

Please help

Steve

Comments (4)

Hi, this took me a while to debug, so I'm posting the solution here. I started by downloading a clean copy of GATK core platform from GitHub. When I first tried building by running ant, I got the compiler errors below. The reason turned out to be that an unrelated jar (gsea2-2.0.12.jar) was on my CLASSPATH (this is from another Broad tool I've been using - Gene Set Enrichment Analysis). gsea2-2.0.12.jar apparently contains outdated versions of apache math and io packages which conflict with the GATK versions. Taking this jar off my CLASSPATH fixed the issue.

-Ben

Ps. the compiler errors were:

gatk.compile.internal.source:
    [javac] Compiling 681 source files to /prog/GATK/gatk_platform_git/build/java/classes
    [javac] /prog/GATK/gatk_platform_git/public/java/src/org/broadinstitute/sting/commandline/ParsingEngine.java:260: error: incompatible types
    [javac]         for (String line: FileUtils.readLines(file))
    [javac]                                              ^
    [javac]   required: String
    [javac]   found:    Object
    [javac] /prog/GATK/gatk_platform_git/public/java/src/org/broadinstitute/sting/utils/MannWhitneyU.java:50: error: no suitable constructor found for NormalDistributionImpl(double,double,double)
    [javac]     private static NormalDistribution APACHE_NORMAL = new NormalDistributionImpl(0.0,1.0,1e-2);
    [javac]                                                       ^
    [javac]     constructor NormalDistributionImpl.NormalDistributionImpl() is not applicable
    [javac]       (actual and formal argument lists differ in length)
    [javac]     constructor NormalDistributionImpl.NormalDistributionImpl(double,double) is not applicable
    [javac]       (actual and formal argument lists differ in length)
    [javac] Note: Some input files use or override a deprecated API.
    [javac] Note: Recompile with -Xlint:deprecation for details.
    [javac] Note: Some input files use unchecked or unsafe operations.
    [javac] Note: Recompile with -Xlint:unchecked for details.
    [javac] 2 errors

BUILD FAILED
/prog/GATK/gatk_platform_git/build.xml:454: Compile failed; see the compiler error output for details.
Comments (8)

Hi guys, I've seen this error has been reported other times, for different reasons. The thing is that, the bam file I'm using to reduce the reads has been processed through GATK pipeline without problems, realignment and recalibration included. Therefore, I assumed the bam file generated after BQSR would be GATK-compliant. I was running with Queue, so I just run here the exact command passed to the job in an interactive mode, to see what happens.

Here below is the full command and error message (apologies for lengthy output), where there's no stack trace after the error.

        [fles@login07 reduced]$ 'java'  '-Xmx12288m'  '-Djava.io.tmpdir=/scratch/scratch/fles/project_analysis/reduced/tmp'  '-cp' '/home/fles/applications/Queue-2.7-4-g6f46d11/Queue.jar'  'org.broadinstitute.sting.gatk.CommandLineGATK'  '-T' 'ReduceReads'  '-I' '/home/fles/Scratch/project_analysis/recalibrated/projectTrios.U1_PJ5208467.clean.dedup.recal.bam'  '-R' '/home/fles/Scratch/gatkbundle_2.5/human_g1k_v37.fasta'  '-o' '/scratch/scratch/fles/project_analysis/reduced/projectTrios.U1_PJ5208467.recal.reduced.bam'
        INFO  09:27:21,728 HelpFormatter - -------------------------------------------------------------------------------- 
        INFO  09:27:21,730 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.7-4-g6f46d11, Compiled 2013/10/10 17:29:52 
        INFO  09:27:21,731 HelpFormatter - Copyright (c) 2010 The Broad Institute 
        INFO  09:27:21,731 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk 
        INFO  09:27:21,735 HelpFormatter - Program Args: -T ReduceReads -I /home/fles/Scratch/project_analysis/recalibrated/projectTrios.U1_PJ5208467.clean.dedup.recal.bam -R /home/fles/Scratch/gatkbundle_2.5/human_g1k_v37.fasta -o /scratch/scratch/fles/project_analysis/reduced/projectTrios.U1_PJ5208467.recal.reduced.bam 
        INFO  09:27:21,735 HelpFormatter - Date/Time: 2013/11/08 09:27:21 
        INFO  09:27:21,735 HelpFormatter - -------------------------------------------------------------------------------- 
        INFO  09:27:21,735 HelpFormatter - -------------------------------------------------------------------------------- 
        INFO  09:27:34,156 GenomeAnalysisEngine - Strictness is SILENT 
        INFO  09:27:34,491 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 40 
        INFO  09:27:34,503 SAMDataSource$SAMReaders - Initializing SAMRecords in serial 
        INFO  09:27:34,627 SAMDataSource$SAMReaders - Done initializing BAM readers: total time 0.12 
        INFO  09:27:35,039 GenomeAnalysisEngine - Preparing for traversal over 1 BAM files 
        INFO  09:27:35,045 GenomeAnalysisEngine - Done preparing for traversal 
        INFO  09:27:35,045 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING] 
        INFO  09:27:35,046 ProgressMeter -        Location processed.reads  runtime per.1M.reads completed total.runtime remaining 
        INFO  09:27:35,080 ReadShardBalancer$1 - Loading BAM index data 
        INFO  09:27:35,081 ReadShardBalancer$1 - Done loading BAM index data 
        INFO  09:28:05,059 ProgressMeter -      1:18958138        1.00e+06   30.0 s       30.0 s      0.6%        81.8 m    81.3 m 
        INFO  09:28:35,069 ProgressMeter -      1:46733396        2.30e+06   60.0 s       26.0 s      1.5%        66.4 m    65.4 m 
        INFO  09:29:05,079 ProgressMeter -      1:92187730        3.50e+06   90.0 s       25.0 s      3.0%        50.5 m    49.0 m 
        INFO  09:29:35,088 ProgressMeter -     1:145281942        4.90e+06  120.0 s       24.0 s      4.7%        42.7 m    40.7 m 
        INFO  09:30:05,098 ProgressMeter -     1:152323864        6.40e+06    2.5 m       23.0 s      4.9%        50.9 m    48.4 m 
        INFO  09:30:35,893 ProgressMeter -     1:181206886        7.70e+06    3.0 m       23.0 s      5.8%        51.4 m    48.4 m 
        INFO  09:31:05,902 ProgressMeter -     1:217604563        8.90e+06    3.5 m       23.0 s      7.0%        49.9 m    46.4 m 
        INFO  09:31:35,913 ProgressMeter -      2:14782401        1.02e+07    4.0 m       23.0 s      8.5%        47.0 m    43.0 m 
        INFO  09:32:05,922 ProgressMeter -      2:62429207        1.15e+07    4.5 m       23.0 s     10.0%        44.8 m    40.3 m 
        INFO  09:32:35,931 ProgressMeter -      2:97877374        1.28e+07    5.0 m       23.0 s     11.2%        44.7 m    39.7 m 
        INFO  09:33:06,218 ProgressMeter -     2:135574018        1.42e+07    5.5 m       23.0 s     12.4%        44.5 m    38.9 m 
        INFO  09:33:36,227 ProgressMeter -     2:179431307        1.56e+07    6.0 m       23.0 s     13.8%        43.5 m    37.5 m 
        INFO  09:34:06,237 ProgressMeter -     2:216279690        1.69e+07    6.5 m       23.0 s     15.0%        43.4 m    36.9 m 
        INFO  09:34:36,248 ProgressMeter -      3:14974731        1.81e+07    7.0 m       23.0 s     16.4%        42.9 m    35.9 m 
        INFO  09:35:07,073 ProgressMeter -      3:52443620        1.94e+07    7.5 m       23.0 s     17.6%        42.9 m    35.4 m 
        INFO  09:35:37,084 ProgressMeter -     3:111366536        2.05e+07    8.0 m       23.0 s     19.5%        41.3 m    33.2 m 
        INFO  09:36:07,094 ProgressMeter -     3:155571144        2.18e+07    8.5 m       23.0 s     20.9%        40.8 m    32.3 m 
        INFO  09:36:37,103 ProgressMeter -       4:3495327        2.31e+07    9.0 m       23.0 s     22.4%        40.4 m    31.3 m 
        INFO  09:37:07,114 ProgressMeter -      4:48178306        2.43e+07    9.5 m       23.0 s     23.8%        40.0 m    30.5 m 
        INFO  09:37:37,270 ProgressMeter -     4:106747046        2.56e+07   10.0 m       23.0 s     25.7%        39.0 m    29.0 m 
        INFO  09:38:07,483 ProgressMeter -     4:181303657        2.69e+07   10.5 m       23.0 s     28.1%        37.5 m    26.9 m 
        INFO  09:38:37,493 ProgressMeter -      5:41149454        2.81e+07   11.0 m       23.0 s     29.7%        37.1 m    26.1 m 
        INFO  09:38:51,094 GATKRunReport - Uploaded run statistics report to AWS S3 
        ##### ERROR ------------------------------------------------------------------------------------------
        ##### ERROR A USER ERROR has occurred (version 2.7-4-g6f46d11): 
        ##### ERROR
        ##### ERROR This means that one or more arguments or inputs in your command are incorrect.
        ##### ERROR The error message below tells you what is the problem.
        ##### ERROR
        ##### ERROR If the problem is an invalid argument, please check the online documentation guide
        ##### ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
        ##### ERROR
        ##### ERROR Visit our website and forum for extensive documentation and answers to 
        ##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
        ##### ERROR
        ##### ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
        ##### ERROR
        ##### ERROR MESSAGE: SAM/BAM file /home/fles/Scratch/project_analysis/recalibrated/projectTrios.U1_PJ5208467.clean.dedup.recal.bam is malformed: Read error; BinaryCodec in readmode; file: /home/fles/Scratch/project_analysis/recalibrated/projectTrios.U1_PJ5208467.clean.dedup.recal.bam
        ##### ERROR ------------------------------------------------------------------------------------------

Following your usual advice, I validated the bam file produced by BQSR with Picard and I get the exact same error, but no specific error indication

        [fles@login07 reduced]$ java -jar ~/applications/picard-tools-1.102/ValidateSamFile.jar \
        > INPUT=/home/fles/Scratch/project_analysis/recalibrated/projectTrios.U1_PJ5208467.clean.dedup.recal.bam \
        > IGNORE_WARNINGS=TRUE
        [Fri Nov 08 09:59:42 GMT 2013] net.sf.picard.sam.ValidateSamFile INPUT=/home/fles/Scratch/project_analysis/recalibrated/projectTrios.U1_PJ5208467.clean.dedup.recal.bam IGNORE_WARNINGS=true    MAX_OUTPUT=100 VALIDATE_INDEX=true IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
        [Fri Nov 08 09:59:42 GMT 2013] Executing as fles@login07 on Linux 2.6.18-194.11.4.el5 amd64; Java HotSpot(TM) 64-Bit Server VM 1.7.0_45-b18; Picard version: 1.102(1591)
        INFO    2013-11-08 10:01:01 SamFileValidator    Validated Read    10,000,000 records.  Elapsed time: 00:01:18s.  Time for last 10,000,000:   78s.  Last read position: 1:204,966,172
        INFO    2013-11-08 10:02:19 SamFileValidator    Validated Read    20,000,000 records.  Elapsed time: 00:02:36s.  Time for last 10,000,000:   78s.  Last read position: 2:232,121,396
        INFO    2013-11-08 10:03:36 SamFileValidator    Validated Read    30,000,000 records.  Elapsed time: 00:03:54s.  Time for last 10,000,000:   77s.  Last read position: 4:123,140,629
        [Fri Nov 08 10:04:00 GMT 2013] net.sf.picard.sam.ValidateSamFile done. Elapsed time: 4.30 minutes.
        Runtime.totalMemory()=300941312
        To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp
        Exception in thread "main" net.sf.samtools.util.RuntimeIOException: Read error; BinaryCodec in readmode; file: /home/fles/Scratch/project_analysis/recalibrated/projectTrios.U1_PJ5208467.clean.dedup.recal.bam
            at net.sf.samtools.util.BinaryCodec.readBytesOrFewer(BinaryCodec.java:397)
            at net.sf.samtools.util.BinaryCodec.readBytes(BinaryCodec.java:371)
            at net.sf.samtools.util.BinaryCodec.readBytes(BinaryCodec.java:357)
            at net.sf.samtools.BAMRecordCodec.decode(BAMRecordCodec.java:200)
            at net.sf.samtools.BAMFileReader$BAMFileIterator.getNextRecord(BAMFileReader.java:558)
            at net.sf.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:532)
            at net.sf.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:522)
            at net.sf.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:481)
            at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:687)
            at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:665)
            at net.sf.picard.sam.SamFileValidator.validateSamRecordsAndQualityFormat(SamFileValidator.java:241)
            at net.sf.picard.sam.SamFileValidator.validateSamFile(SamFileValidator.java:177)
            at net.sf.picard.sam.SamFileValidator.validateSamFileSummary(SamFileValidator.java:104)
            at net.sf.picard.sam.ValidateSamFile.doWork(ValidateSamFile.java:164)
            at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
            at net.sf.picard.sam.ValidateSamFile.main(ValidateSamFile.java:100)
        Caused by: java.io.IOException: Unexpected compressed block length: 1
            at net.sf.samtools.util.BlockCompressedInputStream.readBlock(BlockCompressedInputStream.java:358)
            at net.sf.samtools.util.BlockCompressedInputStream.available(BlockCompressedInputStream.java:113)
            at net.sf.samtools.util.BlockCompressedInputStream.read(BlockCompressedInputStream.java:238)
            at java.io.DataInputStream.read(DataInputStream.java:149)
            at net.sf.samtools.util.BinaryCodec.readBytesOrFewer(BinaryCodec.java:395)

any suggestions on what I might do wrong?

Comments (21)

Dear All,

I've encountered the following error while processing one of the regions from an interval file that I want to re-discover/genotype with the HC. Note that I've processed the other 4.2mln regions without any problems. A quick search on the forum did not lead to any results. Let me know if you'd like more information!

Command:

~/tools/jdk1.7.0_25/bin/java -Xmx8g \ -jar ~/tools/GenomeAnalysisTK-2.7-2-g6bda569/GenomeAnalysisTK.jar \ -T HaplotypeCaller \ -L ~/gonl/projects/SV/ug/gonl.union_pindel_ug_clever.sites.2.vcf.gz \ -L 1:237759920-238000001 \ -nct 6 \ -isr INTERSECTION \ -o ~/results/trio-analysis/hc/1_237759920-238000001.vcf \ -R /target/gpfs2/gcc/resources/hg19/indices/human_g1k_v37.fa \ -I ~/gonl/projects/trio-analysis/resources/bqsr2.bams.list \ -XL ~/gonl/projects/accessibleGenome/results/ALL.accessible.out.mask.intervals \ -minPruning 5 \ 2>&1 | tee /target/gpfs2/gcc/home/lfrancioli/logs/trio-analysis/hc/1_237759920-238000001.out

Error:

`##### ERROR ------------------------------------------------------------------------------------------

ERROR stack trace

java.lang.IllegalStateException: PairHMM Log Probability cannot be greater than 0: haplotype: [84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84], read: [84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84], result: 0.002992 at org.broadinstitute.sting.utils.pairhmm.PairHMM.computeReadLikelihoodGivenHaplotypeLog10(PairHMM.java:131) at org.broadinstitute.sting.gatk.walkers.haplotypecaller.LikelihoodCalculationEngine.computeReadLikelihoods(LikelihoodCalculationEngine.java:262) at org.broadinstitute.sting.gatk.walkers.haplotypecaller.LikelihoodCalculationEngine.computeReadLikelihoods(LikelihoodCalculationEngine.java:205) at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:770) at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:140) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions$TraverseActiveRegionMap.apply(TraverseActiveRegions.java:708) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions$TraverseActiveRegionMap.apply(TraverseActiveRegions.java:704) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.executeSingleThreaded(NanoScheduler.java:274) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.execute(NanoScheduler.java:245) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse(TraverseActiveRegions.java:273) at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse(TraverseActiveRegions.java:78) at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:99) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:313) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:91)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.7-2-g6bda569):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: PairHMM Log Probability cannot be greater than 0: haplotype: [84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84], read: [84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84], result: 0.002992`
ERROR ------------------------------------------------------------------------------------------
Comments (1)

I am trying to liftover from NIST b37 to hg19. I have all the files I need and I can kick off the liftover just fine, but I keep running into problems because the NIST vcf has tags in the variant line INFO field that are not in the header. ##### ERROR MESSAGE: Key PLHSWG found in VariantContext field INFO at chr1:52238 but this key isn't defined in the VCFHeader. We require all VCFs to have complete VCF headers by default

I identified about 90 tags that are not properly documented in the header. Is there a way to ignore all of these INFO header lapses?

Comments (7)

Hi, I have an error in the step BaseRecalibrator and even increasing the memory allocated to the job, I still have the same error and nothing found on previous published posts :

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

org.broadinstitute.sting.utils.exceptions.ReviewedStingException: Insufficient buffer size for Xs overhanging genome -- expand BUFFER at org.broadinstitute.sting.gatk.datasources.providers.ReferenceView.getReferenceBases(ReferenceView.java:121) at org.broadinstitute.sting.gatk.datasources.providers.ReadReferenceView$Provider.getBases(ReadReferenceView.java:87) at org.broadinstitute.sting.gatk.contexts.ReferenceContext.fetchBasesFromProvider(ReferenceContext.java:145) at org.broadinstitute.sting.gatk.contexts.ReferenceContext.getBases(ReferenceContext.java:189) at org.broadinstitute.sting.gatk.walkers.bqsr.BaseRecalibrator.calculateIsSNP(BaseRecalibrator.java:335) at org.broadinstitute.sting.gatk.walkers.bqsr.BaseRecalibrator.map(BaseRecalibrator.java:253) at org.broadinstitute.sting.gatk.walkers.bqsr.BaseRecalibrator.map(BaseRecalibrator.java:132) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano$TraverseReadsMap.apply(TraverseReadsNano.java:228) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano$TraverseReadsMap.apply(TraverseReadsNano.java:216) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.executeSingleThreaded(NanoScheduler.java:274) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.execute(NanoScheduler.java:245) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano.traverse(TraverseReadsNano.java:102) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano.traverse(TraverseReadsNano.java:56) at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:108) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:311) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:91)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.6-5-gba531bd):
ERROR
ERROR Please check the documentation guide to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Insufficient buffer size for Xs overhanging genome -- expand BUFFER
ERROR ------------------------------------------------------------------------------------------

Thank you in advance

Comments (3)

on the forum page

http://gatkforums.broadinstitute.org/discussion/1209/how-to-run-the-gatk-for-the-first-time#latest

there are two examples. The first runs fine. The second generates this error

MESSAGE: Bad input: We encountered a non-standard non-IUPAC base in the provided reference: '10'

but the input files are the same. I only changed "Reads" to "Loci" in the command. I am running Unix so I do not need to retype the entire command. This command works fine

java -jar GenomeAnalysisTK.jar -T CountReads -R exampleFASTA.fasta -I exampleBAM.bam

This command produces the error

java -jar GenomeAnalysisTK.jar -T CountLoci -R exampleFASTA.fasta -I exampleBAM.bam -o output.txt

Any suggestions?

Comments (3)

Hi all, I'm trying to perform BQRS on a bam file I have. Unfortunately I get this error:

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
org.broadinstitute.sting.utils.exceptions.ReviewedStingException: START (0) > (-1) STOP -- this should never happen, please check read: HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 2/2 101b aligned read. (CIGAR: 5D74M27S)

The culprit appears to be this read pair:

HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 147 chr2    230419662   24  5D74M27S    =   230419667   -74 GAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGTGAAAGGAAGGGAAAAGAAAAAGGAAAGGAAGGCAATCCCTGCCCAGGTTCTTAATTTTC   #####A>:3CC>;=>DC@;>66;.3@DAA>CA@77.)((./))@FBB.<<??/9*0*******00*?1***1*1)1)<)B3++2+2+22++2222+4++B=   PG:Z:MarkDuplicates RG:Z:GB_L008.1  NM:i:9  AS:i:43 XS:i:45
HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 99  chr2    230419667   53  83M18S  =   230419662   74  GAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAGAAAGGAAGGAAAAAGAGAAAGGGAAGGAAGGAAATTCATGCTCAGTATCTAATTTTTA   ??;ADDDDHBF3DA=GBGB@D;EFC<3CDHBHICDEGEGIE=@@A@D@;C;;2?@7;=7>>;5>;;@B1<@CB<?>>::4++>@@>CC44>>@DC(:CA##   PG:Z:MarkDuplicates RG:Z:GB_L008.1  NM:i:0  AS:i:83 XS:i:50

Program arguments were:

-R /lustre1/genomes/hg19/fa/hg19.fa -knownSites /lustre1/genomes/hg19/annotation/dbSNP-137.chr.vcf -I GB_dedup.realign.bam -T BaseRecalibrator --covariate QualityScoreCovariate --covariate CycleCovariate --covariate ContextCovariate --covariate ReadGroupCovariate --unsafe ALLOW_SEQ_DICT_INCOMPATIBILITY -nct 64 -o jobdir/GB.grp

I'm running the latest nightbuild of GATK. Any hint is very much appreciated

d

Comments (30)

Hello,

sorry if i missed the same problem in other threads in the forum... but we are having trouble running BaseRecalibrator in a sample and i couldn't find the solution.

I tried many steps and here is what i've found until now:

1 - Other samples work fine

2 - Running picard ValidateSamFile in realigned.bam (after IndelRealigner) gives many erros :
2a - Mate negative strand flag does not match read negative strand flag of mate
2b - Mate alignment does not match alignment start of mate
3c - Value was put into PairInfoMap more than once. (fatal)

3 - Running BaseRecalibrator with option -L 1:428-249250621 works fine!

After the fact that -L works fine i discarded the problem in vcf files and reference file. I don't know how to go further in this investigation since GATK 1 realined.bam also gives me the errors in (2) and those error are peanuts comparing the total number of reads.

The big difference here is that we're are using bwa7.

Any ideas? Thanks!

(i'm filtering out "secondary hits" given by bwa7 and will update this thread, if it works it may be helpful in the future)

GATK output:

INFO 14:11:47,441 HelpFormatter - -------------------------------------------------------------------------------- INFO 14:11:47,443 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.4-9-g532efad, Compiled 2013/03/19 07:35:36 INFO 14:11:47,443 HelpFormatter - Copyright (c) 2010 The Broad Institute INFO 14:11:47,443 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk INFO 14:11:47,447 HelpFormatter - Program Args: -nct 8 -T BaseRecalibrator -I /mnt/work/rlb/pac661825//OUT_661825.realigned.bam -R ../data/databases//1KGP/GRCh37_female_exome_mt1kg.fasta --knownSites ../data/databases//dbSNP/dbSNP_137/00-All.vcf -o /mnt/work/rlb/pac661825//OUT_661825.grp INFO 14:11:47,447 HelpFormatter - Date/Time: 2013/03/26 14:11:47 INFO 14:11:47,447 HelpFormatter - -------------------------------------------------------------------------------- INFO 14:11:47,447 HelpFormatter - -------------------------------------------------------------------------------- INFO 14:11:47,458 ArgumentTypeDescriptor - Dynamically determined type of ../data/databases/dbSNP/dbSNP_137/00-All.vcf to be VCF INFO 14:11:47,500 GenomeAnalysisEngine - Strictness is SILENT INFO 14:11:47,558 GenomeAnalysisEngine - Downsampling Settings: No downsampling INFO 14:11:47,565 SAMDataSource$SAMReaders - Initializing SAMRecords in serial INFO 14:11:47,577 SAMDataSource$SAMReaders - Done initializing BAM readers: total time 0.01 INFO 14:11:47,587 RMDTrackBuilder - Loading Tribble index from disk for file ../data/databases/dbSNP/dbSNP_137/00-All.vcf INFO 14:11:47,704 MicroScheduler - Running the GATK in parallel mode with 8 total threads, 8 CPU thread(s) for each of 1 data thread(s), of 8 processors available on this machine INFO 14:11:47,745 GenomeAnalysisEngine - Creating shard strategy for 1 BAM files INFO 14:11:47,750 GenomeAnalysisEngine - Done creating shard strategy INFO 14:11:47,750 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING] INFO 14:11:47,750 ProgressMeter - Location processed.reads runtime per.1M.reads completed total.runtime remaining INFO 14:11:47,773 BaseRecalibrator - The covariates being used here:
INFO 14:11:47,773 BaseRecalibrator - ReadGroupCovariate INFO 14:11:47,773 BaseRecalibrator - QualityScoreCovariate INFO 14:11:47,773 BaseRecalibrator - ContextCovariate INFO 14:11:47,774 ContextCovariate - Context sizes: base substitution model 2, indel substitution model 3 INFO 14:11:47,774 BaseRecalibrator - CycleCovariate INFO 14:11:47,776 ReadShardBalancer$1 - Loading BAM index data for next contig INFO 14:11:47,777 ReadShardBalancer$1 - Done loading BAM index data for next contig INFO 14:12:18,626 ProgressMeter - 1:15956928 1.10e+06 30.0 s 28.0 s 0.5% 95.1 m 94.6 m INFO 14:12:48,655 ProgressMeter - 1:34102053 2.70e+06 60.0 s 22.0 s 1.1% 89.0 m 88.0 m INFO 14:13:18,685 ProgressMeter - 1:59096606 4.50e+06 90.0 s 20.0 s 1.9% 77.1 m 75.6 m INFO 14:13:48,714 ProgressMeter - 1:103467532 5.90e+06 120.0 s 20.0 s 3.4% 58.7 m 56.7 m INFO 14:14:18,745 ProgressMeter - 1:153234111 7.50e+06 2.5 m 20.0 s 5.0% 49.5 m 47.0 m INFO 14:14:48,774 ProgressMeter - 1:172414433 9.30e+06 3.0 m 19.0 s 5.7% 53.1 m 50.1 m INFO 14:15:19,054 ProgressMeter - 1:208266349 1.10e+07 3.5 m 19.0 s 6.9% 51.3 m 47.8 m INFO 14:15:49,095 ProgressMeter - 1:247611815 1.27e+07 4.0 m 19.0 s 8.2% 49.3 m 45.2 m INFO 14:15:56,507 GATKRunReport - Uploaded run statistics report to AWS S3

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

org.broadinstitute.sting.utils.exceptions.ReviewedStingException: START (0) > (-1) STOP -- this should never happen -- call Mauricio! at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipByReferenceCoordinates(ReadClipper.java:537) at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipByReferenceCoordinatesLeftTail(ReadClipper.java:176) at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipAdaptorSequence(ReadClipper.java:389) at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipAdaptorSequence(ReadClipper.java:392) at org.broadinstitute.sting.gatk.walkers.bqsr.BaseRecalibrator.map(BaseRecalibrator.java:244) at org.broadinstitute.sting.gatk.walkers.bqsr.BaseRecalibrator.map(BaseRecalibrator.java:131) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano$TraverseReadsMap.apply(TraverseReadsNano.java:230) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano$TraverseReadsMap.apply(TraverseReadsNano.java:218) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler$ReadMapReduceJob.run(NanoScheduler.java:471) at java.util.concurrent.Executors$RunnableAdapter.call(Executors.java:471) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:334) at java.util.concurrent.FutureTask.run(FutureTask.java:166) at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1146) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615) at java.lang.Thread.run(Thread.java:679)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.4-9-g532efad):
ERROR
ERROR Please visit the wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: START (0) > (-1) STOP -- this should never happen -- call Mauricio!
ERROR ------------------------------------------------------------------------------------------
Comments (1)

Hi to all I have a problem in understanding an error output produced by PrintReads tool. This is my command line(the recal.grp file is correctly produced by BaseRecalibrator tool):

java -jar /Archive/Software/GATK2.1-8/GenomeAnalysisTK.jar -T PrintReads -I /Path-to-BAMfile -BQSR /Path-to-recal.grp -o /Path-to-output

The error output is:

ERROR ------------------------------------------------------------------------------------------
ERROR A USER ERROR has occurred (version 2.1-8-g5efb575):
ERROR The invalid arguments or inputs must be corrected before the GATK can proceed
ERROR Please do not post this error to the GATK forum
ERROR
ERROR See the documentation (rerun with -h) for this tool to view allowable command-line arguments.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Walker requires a reference but none was provided.
ERROR ------------------------------------------------------------------------------------------

As apparently no further information are available I cannot understand what is the issue. Thank for the help! Giuliano

Comments (1)

INFO 17:40:38,765 ProgressMeter - chrX:147886444 3.21e+07 5.5 h 10.3 m 97.9% 5.6 h 7.1 m INFO 17:41:08,775 ProgressMeter - chrX:151653849 3.21e+07 5.5 h 10.3 m 98.0% 5.6 h 6.7 m INFO 17:41:38,785 ProgressMeter - chrX:153812787 3.22e+07 5.5 h 10.3 m 98.1% 5.6 h 6.5 m

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.NoClassDefFoundError: net/sf/samtools/util/CloserUtil at net.sf.picard.util.PeekableIterator.close(PeekableIterator.java:46) at net.sf.picard.sam.MergingSamRecordIterator.addIfNotEmpty(MergingSamRecordIterator.java:169) at net.sf.picard.sam.MergingSamRecordIterator.next(MergingSamRecordIterator.java:125) at net.sf.picard.sam.MergingSamRecordIterator.next(MergingSamRecordIterator.java:39) at org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:100) at org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:84) at org.broadinstitute.sting.gatk.datasources.reads.SAMDataSource$ReleasingIterator.next(SAMDataSource.java:1091) at org.broadinstitute.sting.gatk.datasources.reads.SAMDataSource$ReleasingIterator.next(SAMDataSource.java:1057) at org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.getNextRecord(CountingFilteringIterator.java:105) at org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.next(CountingFilteringIterator.java:81) at org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.next(CountingFilteringIterator.java:41) at org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:100) at org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:84) at org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.next(VerifyingSamIterator.java:24) at org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.next(VerifyingSamIterator.java:12) at org.broadinstitute.sting.utils.baq.ReadTransformingIterator.next(ReadTransformingIterator.java:36) at org.broadinstitute.sting.utils.baq.ReadTransformingIterator.next(ReadTransformingIterator.java:15) at net.sf.picard.util.PeekableIterator.advance(PeekableIterator.java:71) at net.sf.picard.util.PeekableIterator.next(PeekableIterator.java:57) at org.broadinstitute.sting.gatk.datasources.reads.ReadShard.fill(ReadShard.java:135) at org.broadinstitute.sting.gatk.datasources.reads.ReadShardBalancer$1.advance(ReadShardBalancer.java:153) at org.broadinstitute.sting.gatk.datasources.reads.ReadShardBalancer$1.next(ReadShardBalancer.java:116) at org.broadinstitute.sting.gatk.datasources.reads.ReadShardBalancer$1.next(ReadShardBalancer.java:75) at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:65) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:281) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:91) Caused by: java.lang.ClassNotFoundException: net.sf.samtools.util.CloserUtil at java.net.URLClassLoader$1.run(URLClassLoader.java:199) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(URLClassLoader.java:190) at java.lang.ClassLoader.loadClass(ClassLoader.java:307) at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:301) at java.lang.ClassLoader.loadClass(ClassLoader.java:248) ... 29 more Caused by: java.util.zip.ZipException: error reading zip file at java.util.zip.ZipFile.read(Native Method) at java.util.zip.ZipFile.access$1200(ZipFile.java:29) at java.util.zip.ZipFile$ZipFileInputStream.read(ZipFile.java:447) at java.util.zip.ZipFile$1.fill(ZipFile.java:230) at java.util.zip.InflaterInputStream.read(InflaterInputStream.java:141) at java.util.jar.Manifest$FastInputStream.fill(Manifest.java:422) at java.util.jar.Manifest$FastInputStream.readLine(Manifest.java:358) at java.util.jar.Manifest$FastInputStream.readLine(Manifest.java:390) at java.util.jar.Attributes.read(Attributes.java:359) at java.util.jar.Manifest.read(Manifest.java:182) at java.util.jar.Manifest.(Manifest.java:52) at java.util.jar.JarFile.getManifestFromReference(JarFile.java:167) at java.util.jar.JarFile.getManifest(JarFile.java:148) at sun.misc.URLClassPath$JarLoader$2.getManifest(URLClassPath.java:696) at java.net.URLClassLoader.defineClass(URLClassLoader.java:228) at java.net.URLClassLoader.access$000(URLClassLoader.java:58) at java.net.URLClassLoader$1.run(URLClassLoader.java:197) ... 34 more

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.3-9-ge5ebf34):
ERROR
ERROR Please visit the wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: net/sf/samtools/util/CloserUtil
ERROR ------------------------------------------------------------------------------------------

Any Idea what is the solution??

Comments (10)

Dear expert,

When I run gatk with fellow command,

java -Xmx10g -Xms10g -jar ~/bin/GenomeAnalysisTK-2.3-4-g57ea19f/GenomeAnalysisTK.jar \ -T BaseRecalibrator \ -R Homo_sapiens.GRCh37.63/bak/Homo_sapiens.GRCh37.63.dna.chromosome.fa \ -knownSites ~/bin/GenomeAnalysisTK-2.3-4-g57ea19f/dbsnp_137.hg19.vcf \ -I input_4.bam \ -o mySample_CovarTable_Recal.grp

I got this error:

INFO 22:25:22,825 RMDTrackBuilder - Creating Tribble index in memory for file ~/bin/GenomeAnalysisTK-2.3-4-g57ea19f/dbsnp_137.hg19.vcf

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.NoClassDefFoundError: com/sun/javadoc/ProgramElementDoc ... ... ...

ERROR MESSAGE: com/sun/javadoc/ProgramElementDoc
Comments (2)

Hi,

I got this error today running BaseRecalibrator:

ERROR stack trace

java.lang.NullPointerException at java.util.concurrent.locks.AbstractQueuedSynchronizer.hasQueuedPredecessors(AbstractQueuedSynchronizer.java:1453) at java.util.concurrent.locks.ReentrantLock$FairSync.tryAcquire(ReentrantLock.java:240) at java.util.concurrent.locks.AbstractQueuedSynchronizer.acquireInterruptibly(AbstractQueuedSynchronizer.java:1158) at java.util.concurrent.locks.ReentrantLock.lockInterruptibly(ReentrantLock.java:340) at java.util.concurrent.PriorityBlockingQueue.take(PriorityBlockingQueue.java:244) at org.broadinstitute.sting.utils.nanoScheduler.Reducer.reduceAsMuchAsPossible(Reducer.java:121) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler$MapReduceJob.run(NanoScheduler.java:510) at java.util.concurrent.Executors$RunnableAdapter.call(Executors.java:471) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:334) at java.util.concurrent.FutureTask.run(FutureTask.java:166) at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1110) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:603) at java.lang.Thread.run(Thread.java:636)

The command arguments I used are: -nct 4 -T BaseRecalibrator --intermediate_csv_file inter.csv -I realigned.bam -R Homo_sapiens.GRCh37.68.dna.chromosome.all.fasta -o recal_data.grp --plot_pdf_file recal.pdf -knownSites dbsnp_137.b37.vcf -knownSites Mills_and_1000G_gold_standard.indels.b37.vcf -knownSites 1000G_phase1.indels.b37.vcf --disable_indel_quals

This command has previously worked with other data using the same version of GATK.

Comments (8)

Hi all, I'm running VariantRecalibrator on a SNP set (47 exomes) and I get this error:

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A USER ERROR has occurred (version 2.2-3-gde33222): 
##### ERROR The invalid arguments or inputs must be corrected before the GATK can proceed
##### ERROR Please do not post this error to the GATK forum
##### ERROR
##### ERROR See the documentation (rerun with -h) for this tool to view allowable command-line arguments.
##### ERROR Visit our website and forum for extensive documentation and answers to 
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: NaN LOD value assigned. Clustering with this few variants and these annotations is unsafe. Please consider raising the number of variants used to train the negative model (via --percentBadVariants 0.05, for example) or lowering the maximum number of Gaussians to use in the model (via --maxGaussians 4, for example)
##### ERROR ------------------------------------------------------------------------------------------

this is the command line:

    java -Djava.io.tmpdir=/lustre2/scratch/  -Xmx32g -jar /lustre1/tools/bin/GenomeAnalysisTK-2.2-3.jar \
    -T VariantRecalibrator \
    -R /lustre1/genomes/hg19/fa/hg19.fa \
    -input /lustre1/workspace/Ferrari/Carrera/Analysis/UG/bpd_ug.SNP.vcf \
    -resource:hapmap,VCF,known=false,training=true,truth=true,prior=15.0 /lustre1/genomes/hg19/annotation/hapmap_3.3.hg19.sites.vcf.gz \
    -resource:omni,VCF,known=false,training=true,truth=false,prior=12.0 /lustre1/genomes/hg19/annotation/1000G_omni2.5.hg19.sites.vcf.gz \
    -resource:dbsnp,VCF,known=true,training=false,truth=false,prior=6.0 /lustre1/genomes/hg19/annotation/dbSNP-137.chr.vcf -an QD \
    -an HaplotypeScore \
    -an MQRankSum \
    -an ReadPosRankSum \
    -an FS \
    -an MQ \
    -an DP \
    -an QD \
    -an InbreedingCoeff \
    -mode SNP \
    -recalFile /lustre2/scratch/Carrera/Analysis2/snp.ug.recal.csv \
    -tranchesFile /lustre2/scratch/Carrera/Analysis2/snp.ug.tranches \
    -rscriptFile /lustre2/scratch/Carrera/Analysis2/snp.ug.plot.R \
    -U ALLOW_SEQ_DICT_INCOMPATIBILITY \
    --maxGaussians 6

I've already tried to decrease the --maxGaussians option to 4, I've also added --percentBad option (setting it up to 0.12, as for INDEL) but I still get the error. I've added the option -debug to see what's happening, but apparently this has been removed from GATK-2.2. Any help is appreciated... thanks

Comments (14)

I had annotated raw indel file (given by UnifiedGenotyper), 1000G_omni2.5.b37.sites.vcf and hapmap_3.3.b37.sites.vcf with all possible annotations including QD (QualByDepth) using VariantAnnotator. However, i got an error when i tried to run VariantRecalibrator. It was complaing that QD has not been found in training variant. Is QD important annotation for indel filtering. Can it be ignored ?

P.S. - i did not use sample bam file while annotating training data set.

.
.
.
INFO  15:11:55,999 RMDTrackBuilder - Loading Tribble index from disk for file NCBI_dbsnp_for_GATK.vcf
INFO  15:12:21,650 TraversalEngine -  chr1:128346793        1.98e+07   30.0 s        1.5 s      4.1%        12.1 m    11.6 m
INFO  15:12:51,650 TraversalEngine -  chr9:130658800        5.26e+07   60.0 s        1.1 s     53.9%       111.2 s    51.2 s
INFO  15:13:13,618 VariantDataManager - QD:      mean = NaN      standard deviation = NaN
INFO  15:13:16,417 GATKRunReport - Uploaded run statistics report to AWS S3
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A USER ERROR has occurred (version 2.1-13-g1706365):
##### ERROR The invalid arguments or inputs must be corrected before the GATK can proceed
##### ERROR Please do not post this error to the GATK forum
##### ERROR
##### ERROR See the documentation (rerun with -h) for this tool to view allowable command-line arguments.
##### ERROR Visit our website and forum for extensive documentation and answers to
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: Bad input: Values for QD annotation not detected for ANY training variant in the input callset. VariantAnnotator may be used to add these annotations. See http://www.broadinstitute.org/gsa/wiki/index.php/VariantAnnotator
##### ERROR ------------------------------------------------------------------------------------------
Comments (33)

Hello dear GATK Team,

when trying to run Haplotypecaller on my exome files prepared with ReduceReads i get the error stated below. As you can see the newest GATK Version is used. Also UnifiedGenotyper does not produce any errors on te exact same data (90 SOLiD exomes creatted according to Best Practice v4).

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
org.broadinstitute.sting.utils.exceptions.ReviewedStingException: Somehow the requested coordinate is not covered by the read. Too many deletions?
    at org.broadinstitute.sting.utils.sam.ReadUtils.getReadCoordinateForReferenceCoordinate(ReadUtils.java:447)
    at org.broadinstitute.sting.utils.sam.ReadUtils.getReadCoordinateForReferenceCoordinate(ReadUtils.java:396)
    at org.broadinstitute.sting.utils.sam.ReadUtils.getReadCoordinateForReferenceCoordinate(ReadUtils.java:392)
    at org.broadinstitute.sting.gatk.walkers.annotator.DepthOfCoverage.annotate(DepthOfCoverage.java:56)
    at org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation.annotate(InfoFieldAnnotation.java:24)
    at org.broadinstitute.sting.gatk.walkers.annotator.VariantAnnotatorEngine.annotateContext(VariantAnnotatorEngine.java:223)
    at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:429)
    at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:104)
    at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegion(TraverseActiveRegions.java:249)
    at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.callWalkerMapOnActiveRegions(TraverseActiveRegions.java:204)
    at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.processActiveRegions(TraverseActiveRegions.java:179)
    at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse(TraverseActiveRegions.java:136)
    at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse(TraverseActiveRegions.java:29)
    at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:74)
    at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:281)
    at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
    at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:236)
    at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:146)
    at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:93)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 2.2-3-gde33222):
##### ERROR
##### ERROR Please visit the wiki to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our website and forum for extensive documentation and answers to 
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: Somehow the requested coordinate is not covered by the read. Too many deletions?
##### ERROR ------------------------------------------------------------------------------------------

The Command line used (abbreviated):

java -Xmx30g -jar /home/common/GenomeAnalysisTK-2.2-3/GenomeAnalysisTK.jar \
  -R /home/common/hg19/ucschg19/ucsc.hg19.fasta \
  -T HaplotypeCaller \
  -I ReduceReads/XXXXX.ontarget.MarkDups.nRG.reor.Real.Recal.reduced.bam [x90]\
  --dbsnp /home/common/hg19/dbsnp_135.hg19.vcf \
  -o 93Ind_ped_reduced_HC_snps.raw.vcf \
  -ped familys.ped \
  --pedigreeValidationType SILENT \
  -stand_call_conf 20.0 \
  -stand_emit_conf 10.0
Comments (7)

Hi all,

Has anyone else gotten the following:

java.lang.NullPointerException at org.broadinstitute.sting.gatk.walkers.phasing.PhaseByTransmission.phaseTrioGenotypes(PhaseByTransmission.java:242) at org.broadinstitute.sting.gatk.walkers.phasing.PhaseByTransmission.map(PhaseByTransmission.java:306) at org.broadinstitute.sting.gatk.walkers.phasing.PhaseByTransmission.map(PhaseByTransmission.java:35) at org.broadinstitute.sting.gatk.traversals.TraverseLoci.traverse(TraverseLoci.java:78) at org.broadinstitute.sting.gatk.traversals.TraverseLoci.traverse(TraverseLoci.java:18) at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:62) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:225) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:122) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:236) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:149) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:91)

My command line was: java -jar GenomeAnalysisTK.jar -T PhaseByTransmission -V w01.sorted.vcf -o w01.phased.vcf -f "mom+dad=child" -R hg19.fa

Cheers,

Paul

Comments (19)

Hi all,

I've been analyzing some illumina whole exome sequencing data these days. Yesterday I used GATK(version 2.0) UnifiedGenotyper to call snps and indels with the following commands:

run_gatk.sh -T UnifiedGenotyper -R GRCh37/human_g1k_v37.fasta -I GATK_recal_result.bam -glm BOTH --dbsnp reference/dbsnp_134.b37.vcf -stand_call_conf 50 -stand_emit_conf 10 -o raw2.vcf -dcov 200 --num_threads 10

After running theses commands, I got a vcf file which is very small(when I checked the vcf file, I found these called snps and indels are all from Chromosome1) The error message is as follows:

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

org.broadinstitute.sting.utils.exceptions.ReviewedStingException: Unable to merge temporary Tribble output file. at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.mergeExistingOutput(HierarchicalMicroScheduler.java:269) at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.execute(HierarchicalMicroScheduler.java:105) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:269) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:236) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:146) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:93) Caused by: org.broad.tribble.TribbleException$MalformedFeatureFile: Unable to parse header with error: /rd/tmp/org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub8005277156701491219.tmp (Too many open files), for input source: /rd/tmp/org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub8005277156701491219.tmp at org.broad.tribble.TribbleIndexedFeatureReader.readHeader(TribbleIndexedFeatureReader.java:104) at org.broad.tribble.TribbleIndexedFeatureReader.(TribbleIndexedFeatureReader.java:58) at org.broad.tribble.AbstractFeatureReader.getFeatureReader(AbstractFeatureReader.java:69) at org.broadinstitute.sting.gatk.io.storage.VariantContextWriterStorage.mergeInto(VariantContextWriterStorage.java:182) at org.broadinstitute.sting.gatk.io.storage.VariantContextWriterStorage.mergeInto(VariantContextWriterStorage.java:52) at org.broadinstitute.sting.gatk.executive.OutputMergeTask.merge(OutputMergeTask.java:48) at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.mergeExistingOutput(HierarchicalMicroScheduler.java:263) ... 6 more Caused by: java.io.FileNotFoundException: /rd/tmp/org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub8005277156701491219.tmp (Too many open files) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(FileInputStream.java:120) at org.broad.tribble.util.ParsingUtils.openInputStream(ParsingUtils.java:56) at org.broad.tribble.TribbleIndexedFeatureReader.readHeader(TribbleIndexedFeatureReader.java:96) ... 12 more

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.0-39-gd091f72):
ERROR
ERROR Please visit the wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Unable to merge temporary Tribble output file.
ERROR ------------------------------------------------------------------------------------------

Would you please help me solve it ? Thanks a lot

Comments (1)

ERROR MESSAGE: SAM/BAM file genome_110616_SN365_A_s_7_seq_GQJ-1.pe.bam is malformed: SAM file doesn't have any read groups defined in the header. The GATK no longer supports SAM files without read groups

i am very new to GATK and i was trying to invoke the readcount command and i got the error above what is read groups.

thank you