For a complete, detailed argument reference, refer to the GATK document page here.
DepthOfCoverage is a coverage profiler for a (possibly multi-sample) bam file. It uses a granular histogram that can be user-specified to present useful aggregate coverage data. It reports the following metrics over the entire .bam file:
Because the common question "What proportion of my targeted bases are well-powered to discover SNPs?" is answered by the last matrix on the above list, it is strongly recommended that this walker be run on all samples simultaneously.
For humans, DepthOfCoverage can also be configured to output these statistics aggregated over genes, by providing it with a RefSeq ROD.
DepthOfCoverage also outputs, by default, the total coverage at every locus, and the coverage per sample and/or read group. This behavior can optionally be turned off, or switched to base count mode, where base counts will be output at each locus, rather than total depth.
To get a summary of coverage by each gene, you may supply a refseq (or alternative) gene list via the argument
-geneList /path/to/gene/list.txt
The provided gene list must be of the following format:
585 NM_001005484 chr1 + 58953 59871 58953 59871 1 58953, 59871, 0 OR4F5 cmpl cmpl 0,
587 NM_001005224 chr1 + 357521 358460 357521 358460 1 357521, 358460, 0 OR4F3 cmpl cmpl 0,
587 NM_001005277 chr1 + 357521 358460 357521 358460 1 357521, 358460, 0 OR4F16 cmpl cmpl 0,
587 NM_001005221 chr1 + 357521 358460 357521 358460 1 357521, 358460, 0 OR4F29 cmpl cmpl 0,
589 NM_001005224 chr1 - 610958 611897 610958 611897 1 610958, 611897, 0 OR4F3 cmpl cmpl 0,
589 NM_001005277 chr1 - 610958 611897 610958 611897 1 610958, 611897, 0 OR4F16 cmpl cmpl 0,
589 NM_001005221 chr1 - 610958 611897 610958 611897 1 610958, 611897, 0 OR4F29 cmpl cmpl 0,
If you are on the broad network, the properly-formatted file containing refseq genes and transcripts is located at
/humgen/gsa-hpprojects/GATK/data/refGene.sorted.txt
If you supply the -geneList argument, DepthOfCoverage v3.0 will output an additional summary file that looks as follows:
Gene_Name Total_Cvg Avg_Cvg Sample_1_Total_Cvg Sample_1_Avg_Cvg Sample_1_Cvg_Q3 Sample_1_Cvg_Median Sample_1_Cvg_Q1
SORT1 594710 238.27 594710 238.27 165 245 330
NOTCH2 3011542 357.84 3011542 357.84 222 399 >500
LMNA 563183 186.73 563183 186.73 116 187 262
NOS1AP 513031 203.50 513031 203.50 91 191 290
Note that the gene coverage will be aggregated only over samples (not read groups, libraries, or other types). The -geneList argument also requires specific intervals within genes to be given (say, the particular exons you are interested in, or the entire gene), and it functions by aggregating coverage from the interval level to the gene level, by referencing each interval to the gene in which it falls. Because by-gene aggregation looks for intervals that overlap genes, -geneList is ignored if -omitIntervals is thrown.
We have decided to continue providing and supporting DepthOfCoverage and DiagnoseTargets for the foreseeable future. Going forward, we'll try to integrate them and develop their features to address the main needs of the community. To this end we welcome your continuing feedback, so please feel free to contribute comments and ideas in this thread.
To all who took the time to tell us what you find useful about DoC and DT (and what you wish it could do), a big thank you! This is always very useful to us because it helps us identify which features are most valuable to our users.
Now that DepthOfCoverage is being retired in GATK 2.4, I decided to investigate DiagnoseTargets. I have some questions.
1) Are there plans to support output formats other than VCF? What was great about DOC is I could easily send the output to anyone and it could be easily read. With DT, that requires additional processing.
2) DOC provided summary for intervals as well as samples. DT only does intervals. Is there a way to get per-sample info?
3) DOC output full intervals. DT only outputs the start positions. To get the end positions, an additional step is required. Can that be adjusted?
4) DOC provided coverage info for all intervals. DT only shows covered intervals, so if an interval is not covered, it will not be listed in the output. Is there a way to output all intervals?
Sorry if I sound too critical. I am a big fan of DepthOfCoverage and am disappointed to see it go.
Thank you.
Hi there,
this is my interval_list
chr1 762095 762275 LINC00115|NR_024321 chr1 762280 762414 LINC00115|NR_024321 chr1 762420 762565 LINC00115|NR_024321 chr1 777259 777349 LOC643837 chr1 777391 777481 LOC643837 chr1 777482 777642 LOC643837 chr1 783061 783151 LOC643837 chr1 792270 792446 LOC643837 chr1 861266 861496 NM_152486|SAMD11 chr1 865582 865787 NM_152486|SAMD11 chr1 866331 866507 NM_152486|SAMD11
and this is the output from the sample_interval_summary
chr1:762095-762275 ... chr1:762280-762414 ... chr1:762420-762565 ... chr1:777259-777349 ... chr1:783061-783151 ... chr1:792270-792446 ... chr1:861266-861496 ... chr1:865582-865787 ... chr1:866331-866507 ...
why am I missing two exons?
this is my cmd:
java -Xmx32g -jar /local/apps/gatk/2.5-2-gf57256b/GenomeAnalysisTK.jar -I sample.bam -R .../genome.fa -T DepthOfCoverage -o jtn -geneList hg19.tsv -L exons.list --omitDepthOutputAtEachBase --includeDeletions --interval_merging OVERLAPPING_ONLY -l INFO
Thanks for your input!
/M
I am getting the following error when running DepthOfCoverage:
I have already reheadered my bam file to fix a contig mismatch error, and the fasta dict file was generated automatically by gatk. Moreover, about 160 lines of output are generated, but I do not see any irregularities at the position where the code crashed. Please let me know what I can try. Thank you.
I am running GATK DepthOfCoverage one a bunch of samples (sequenced using Illumina MiSeq). For one of the samples, I am getting the following error:
ERROR MESSAGE: SAM/BAM file SAMFileReader{<file.bam>} appears to be using the wrong encoding for quality scores: we encountered an extremely high quality score of 61; please see the GATK --help documentation for options related to this error
I found a suggestion that I should be using fixMisencodedQuals flag in this case. However, if I do that, "the engine will simply subtract 31 from every quality score as it is read in". That will fix this error, but then all my quality scores will be incorrect.
Furthermore, the BAM file I am using was last recalibrated with GATK. Why is GATK producing files with invalid quality scores?
What should I do?
Any help would be much appreciated.
Hello,
For matched tumor and normal pairs, we easily get insertion and deletion counts from the output of Somatic Indel Detector in GATK. However, when we run multiple samples from the same patient, sometimes calls are made in one sample but not another, so we might not have the numbers for all samples for all indel events. We can get the deletion counts from Depth of Coverage in GATK, but retrieving insertions is trickier.
Does you have a suggestion for how to solve this problem in an automated (ie non-IGV fashion)?
Additionally, as DepthofCoverage is being retired, what do you recommend that we use for getting SNP and deletion counts?
Thank you
Dear team,
I would like to include a RefSeq ROD file in order to get the coverage per gene using the GATK coverage tool (http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_coverage_DepthOfCoverage.html). However, it is not really clear to me how I can easily generate such a file, since I can not find the right documentation. All the links that should point to this information seem to be (incorrectly?) redirected to the main GATK homepage). For example this http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_utils_codecs_refseq_RefSeqCodec.html has a link that points to http://www.broadinstitute.org/gsa/wiki/index.php/RefSeq which is redirected to http://www.broadinstitute.org/gatk/. Can someone point me to the correct docs? Other resources I found also point to the same wiki, which I can't find at the moment..
Kind regards, JJ
Hi,
I am learning to use the DepthofCoverage function to obtain the gene coverage information for a collection of bacterial contigs that were mapped with metagenomic reads. The original post introducing this function is here: http://gatkforums.broadinstitute.org/discussion/40/depthofcoverage-v3-0-how-much-data-do-i-have#latest
In the post, you mentioned the gene list, as follow:
-geneList /path/to/gene/list.txt
The provided gene list must be of the following format:
585 NM_001005484 chr1 + 58953 59871 58953 59871 1 58953, 59871, 0 OR4F5 cmpl cmpl 0,
587 NM_001005224 chr1 + 357521 358460 357521 358460 1 357521, 358460, 0 OR4F3 cmpl cmpl 0,
I have three inquiries:
Thanks so much!
Leo
I was wondering if there is an option to remove duplicate reads when the coverage is determined using DepthOfCoverage from a .BAM file. Or is there an alternate way to remove the duplicate reads.
Thanks Amin
Just in the process of updating our pipeline from v2.3-4-gb8f1308 Lite to v2.4-7-g5e89f01 Academic and have run into a small issue. The command line:
-T UnifiedGenotyper -glm SNP -R /lustre/scratch111/resources/ref/Homo_sapiens/1000Genomes_hs37d5/hs37d5.fa -I /lustre/scratch111/projects/helic/vcf-newpipe/lists/chr1-pooled.list --alleles /lustre/scratch111/projects/helic/vcf-newpipe/pooled/1/1:1-1000000.snps.vcf.gz -L 1:1-1000000 -U LENIENT_VCF_PROCESSING -baq CALCULATE_AS_NECESSARY -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES --standard_min_confidence_threshold_for_calling 4.0 --standard_min_confidence_threshold_for_emitting 4.0 -l INFO -A QualByDepth -A HaplotypeScore -A MappingQualityRankSumTest -A ReadPosRankSumTest -A FisherStrand -A InbreedingCoeff -A DepthOfCoverage -o /lustre/scratch111/projects/helic/vcf-newpipe/pooled/1/1:1-1000000.asnps.vcf.gz.part.vcf.gz
This worked in 2.3.4. But now gives:
Invalid command line: Argument annotation has a bad value: Class DepthOfCoverage is not found; please check that you have specified the class name correctly
I've looked at the release notes but it's not giving me a clue as to what has changed. Has the DepthOfCoverage annotation now been dropped? I've checked and I can reproduce this on the latest nightly (nightly-2013-03-11-g184e5ac)
when " RMDTrackBuilder - Loading Tribble index from disk for file refGene.sorted.txt " error occurs:
is it means that my refGene.sorted.txt or b37.fasta file is badly formed? what should I do ?
Hello,
i have spend many hours trying to run GATK depthofcoverage but it never works.
last try: -T DepthOfCoverage -R /home/remi/Analyse/CNV/ERR125905/bam/Chloroplastgenomebarley.fa -I /home/remi/Analyse/CNV/ERR125905/bam/ERfiltre.bam -L /home/remi/Analyse/CNV/ERR125905/bam/ERfiltre.bed -o /home/remi/Analyse/CNV/FishingCNV_1.5.3/out/ERfiltre.bam.coverage --minMappingQuality 15 --minBaseQuality 10 --omitDepthOutputAtEachBase --logging_level INFO --summaryCoverageThreshold 5 --summaryCoverageThreshold 7 --summaryCoverageThreshold 10 --summaryCoverageThreshold 15 --summaryCoverageThreshold 20 --summaryCoverageThreshold 30 --summaryCoverageThreshold 50
My BAM header seem to be malformed.
ERROR MESSAGE: SAM/BAM file /home/remi/Analyse/CNV/ERR125905/bam/ERfiltre.bam is malformed: SAM file doesn't have any read groups defined in the header. The GATK no longer supports SAM files without read groups
here is the 1rst line of the header:
@SQ SN:Chloroplastgenomebarley LN:136462 @PG ID:bwa PN:bwa VN:0.5.9-r16 ERR125905.35 99 Chloroplastgenomebarley 69543 29 101M = 69854 412 TTTGATCCCTCTGATCCTGTTCTGGATCCAATGTGGAGACAAGGTATGTTCGTAATTCCCTTCATGACTCGTTTAGGAATAACGGATCCTTGGGGTGGTTG D-:D?BDDDDCC-?ADCBBBDDDDD:BDD= :6 C-4<9@62@@<:?=B??B=DC28=B&?:AA:4 ERR125905.35 147 Chloroplastgenomebarley 69854 29 101M = 69543 -412 GGCTTTCTGTCGCTTGTGGGCTTTTCCTATAACGGCTTTTTATGTTCCTGGGATATGGGTATCCGATCCTTATGGACTAACTGGAAAAGTACAAGCTGTAA #################################################A-B49= @@2>+:CCC:@@ 66DD@-@DDD?B::@-CA:5?:ADD?ADBB??
I Have search in the forum and doc about it. I have try to reorder my header with picard:
@HD VN:1.4 SO:unsorted @SQ SN:Chloroplastgenomebarley LN:136462 UR:file:/home/remi/Analyse/REFGEN/Chloroplastgenomebarley.fa M5:7a7b36ef01cc1a2af1c8451ca3800f93 @PG ID:bwa PN:bwa VN:0.5.9-r16 ERR125905.35 99 Chloroplastgenomebarley 69543 29 101M = 69854 412 TTTGATCCCTCTGATCCTGTTCTGGATCCAATGTGGAGACAAGGTATGTTCGTAATTCCCTTCATGACTCGTTTAGGAATAACGGATCCTTGGGGTGGTTG D-:D?BDDDDCC-?ADCBBBDDDDD:BDD= :6 C-4<9@62@@<:?=B??B=DC28=B&?:AA:4 ERR125905.35 147 Chloroplastgenomebarley 69854 29 101M = 69543 -412 GGCTTTCTGTCGCTTGTGGGCTTTTCCTATAACGGCTTTTTATGTTCCTGGGATATGGGTATCCGATCCTTATGGACTAACTGGAAAAGTACAAGCTGTAA #################################################A-B49= @@2>+:CCC:@@ 66DD@-@DDD?B::@-CA:5?:ADD?ADBB??but no more change.
Someone can help me please ?
Regards, Remi
`
Hello, I´m trying to use deptofcoverage to check the coverage of my reads. I already have the indexed bam files (created with sam to bam) and also reordered (reorder SAM/BAM) but they are still not recognized by depthofcoverage and I got this error message:
"Sequences are not currently available for the specified build"
I used "human (homo sapiens) hg19 full" for mapping but I can´t select it, it only allows b37 version.
Any suggestions?
Thank you very much in advance
Gema