Tagged with #bqrs
0 documentation articles | 0 events or announcements | 2 forum discussions


Sorry, there are no publicly available documents of this type with the tag #bqrs. Try one of the other types.
Sorry, there are no publicly available documents of this type with the tag #bqrs. Try one of the other types.

Hi all, I would like to know which best practices are available for BQRS only and, before that, I need some detail on how BQRS works. In particular: suppose I have exome data for multiple samples and a set of intervals that covers all exome baits. One way to perform BQRS is to run the BaseRecalibrator walker on the whole file, using all BAM files available and have a single covariate table; I run PrintReads on each BAM file using the covariate table. Another way, is to run in the very same way feeding with the file containing intervals. This speeds things up because the walker doesn't have to check the whole genome space. Another way, faster, is to run a single BaseRecalibrator process for each interval. This results in a number of covariate tables equal to the number of intervals. I then run the same number of PrintReads and merge the results. If the latter would be enough, I know I can run really fast, but I'm afraid I may get some biased covariate table. I may apply the same procedure on whole genome, choosing the proper set of intervals

Hi all, I'm trying to perform BQRS on a bam file I have. Unfortunately I get this error:

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
org.broadinstitute.sting.utils.exceptions.ReviewedStingException: START (0) > (-1) STOP -- this should never happen, please check read: HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 2/2 101b aligned read. (CIGAR: 5D74M27S)

The culprit appears to be this read pair:

HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 147 chr2    230419662   24  5D74M27S    =   230419667   -74 GAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGTGAAAGGAAGGGAAAAGAAAAAGGAAAGGAAGGCAATCCCTGCCCAGGTTCTTAATTTTC   #####A>:3CC>;=>DC@;>66;.3@DAA>CA@77.)((./))@FBB.<<??/9*0*******00*?1***1*1)1)<)B3++2+2+22++2222+4++B=   PG:Z:MarkDuplicates RG:Z:GB_L008.1  NM:i:9  AS:i:43 XS:i:45
HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 99  chr2    230419667   53  83M18S  =   230419662   74  GAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAGAAAGGAAGGAAAAAGAGAAAGGGAAGGAAGGAAATTCATGCTCAGTATCTAATTTTTA   ??;ADDDDHBF3DA=GBGB@D;EFC<3CDHBHICDEGEGIE=@@A@D@;C;;2?@7;=7>>;5>;;@B1<@CB<?>>::4++>@@>CC44>>@DC(:CA##   PG:Z:MarkDuplicates RG:Z:GB_L008.1  NM:i:0  AS:i:83 XS:i:50

Program arguments were:

-R /lustre1/genomes/hg19/fa/hg19.fa -knownSites /lustre1/genomes/hg19/annotation/dbSNP-137.chr.vcf -I GB_dedup.realign.bam -T BaseRecalibrator --covariate QualityScoreCovariate --covariate CycleCovariate --covariate ContextCovariate --covariate ReadGroupCovariate --unsafe ALLOW_SEQ_DICT_INCOMPATIBILITY -nct 64 -o jobdir/GB.grp

I'm running the latest nightbuild of GATK. Any hint is very much appreciated

d