GATK Best Practices
Recommended workflow for calling variants with GATK

About the Best Practices workflow

This Best Practices workflow is divided in three main sections that are meant to be performed sequentially:

  • Data pre-processing: from raw DNAseq sequence reads (FASTQ files) to analysis-ready reads (BAM files)
  • Variant discovery: from reads (BAM files) to variants (VCF files)
  • Suggested preliminary analyses

This is our recommended workflow for calling variants in DNAseq data from cohorts of samples, in which steps from data processing up to variant calling are performed per-sample, and subsequent steps are performed jointly on all the individuals in the cohort.

Frequently Asked Questions

Comments (0)

There are four major organizational units for next-generation DNA sequencing processes that used throughout the GATK documentation:

  • Lane: The basic machine unit for sequencing. The lane reflects the basic independent run of an NGS machine. For Illumina machines, this is the physical sequencing lane.

  • Library: A unit of DNA preparation that at some point is physically pooled together. Multiple lanes can be run from aliquots from the same library. The DNA library and its preparation is the natural unit that is being sequenced. For example, if the library has limited complexity, then many sequences are duplicated and will result in a high duplication rate across lanes.

  • Sample: A single individual, such as human CEPH NA12878. Multiple libraries with different properties can be constructed from the original sample DNA source. Throughout our documentation, we treat samples as independent individuals whose genome sequence we are attempting to determine. Note that from this perspective, tumor / normal samples are different despite coming from the same individual.

  • Cohort: A collection of samples being analyzed together. This organizational unit is the most subjective and depends very specifically on the design goals of the sequencing project. For population discovery projects like the 1000 Genomes, the analysis cohort is the ~100 individual in each population. For exome projects with many deeply sequenced samples (e.g., ESP with 800 EOMI samples) we divide up the complete set of samples into cohorts of ~50 individuals for multi-sample analyses.

Note that many GATK commands can be run at the lane level, but will give better results seeing all of the data for a single sample, or even all of the data for all samples. Unfortunately, there's a trade-off in computational cost, since running these commands across all of your data simultaneously requires much more computing power. Please see the documentation for each step to understand what is the best way to group or partition your data for that particular process.

Comments (12)

Note that there are many possible ways to achieve a similar result; here we present the way we think gives the best combination of efficiency and quality. This assumes that you are dealing with one or more samples, and each of them was sequenced on one or more lanes.

Let's say we have this example data:

  • sample1_lane1.fq
  • sample1_lane2.fq
  • sample2_lane1.fq
  • sample2_lane2.fq

1. Run all core steps per-lane once

At the basic level, all pre-processing steps are meant to be performed per-lane. Assuming that you received one FASTQ file per lane of sequence data, just run each file through each pre-processing step individually: map & dedup -> realign -> recal.

The example data becomes:

  • sample1_lane1.dedup.realn.recal.bam
  • sample1_lane2.dedup.realn.recal.bam
  • sample2_lane1.dedup.realn.recal.bam
  • sample2_lane2.dedup.realn.recal.bam

2. Merge lanes per sample

Once you have pre-processed each lane individually, you merge lanes belonging to the same sample into a single BAM file.

The example data becomes:

  • sample1.merged.bam
  • sample2.merged.bam

3. Per-sample refinement

You can increase the quality of your results by performing an extra round of dedupping and realignment, this time at the sample level. It is not absolutely required and will increase your computational costs, so it's up to you to decide whether you want to do it on your data, but that's how we do it internally at Broad.

The example data becomes:

  • sample1.merged.dedup.realn.bam
  • sample2.merged.dedup.realn.bam

This gets you two big wins:

  • Dedupping per-sample eliminates PCR duplicates across all lanes in addition to optical duplicates (which are by definition only per-lane)
  • Realigning per-sample means that you will have consistent alignments across all lanes within a sample.

People often ask also if it's worth the trouble to try realigning across all samples in a cohort. The answer is almost always no, unless you have very shallow coverage. The problem is that while it would be lovely to ensure consistent alignments around indels across all samples, the computational cost gets too ridiculous too fast. That being said, for contrastive calling projects -- such as cancer tumor/normals -- we do recommend realigning both the tumor and the normal together in general to avoid slight alignment differences between the two tissue types.

Finally, why not do base recalibration across lanes or across samples? Well, by definition there is no sense in trying to recalibrate across lanes, since the purpose of this processing step is to compensate for the errors made by the machine during sequencing, and the lane is the base unit of the sequencing machine. That said, don't worry if you find yourself needing to recalibrate a BAM file with the lanes already merged -- the GATK's BaseRecalibrator is read group-aware, which means that it will identify separate lanes as such even if they are in the same BAM file, and it will always process them separately.

Comments (15)

1. What file formats do you support for sequencer output?

The GATK supports the BAM format for reads, quality scores, alignments, and metadata (e.g. the lane of sequencing, center of origin, sample name, etc.). No other file formats are supported.

2. How do I get my data into BAM format?

The GATK doesn't have any tools for getting data into BAM format, but many other toolkits exist for this purpose. We recommend you look at Picard and Samtools for creating and manipulating BAM files. Also, many aligners are starting to emit BAM files directly. See BWA for one such aligner.

3. What are the formatting requirements for my BAM file(s)?

All BAM files must satisfy the following requirements:

  • It must be aligned to one of the references described here.
  • It must be sorted in coordinate order (not by queryname and not "unsorted").
  • It must list the read groups with sample names in the header.
  • Every read must belong to a read group.
  • The BAM file must pass Picard validation.

See the BAM specification for more information.

4. What is the canonical ordering of human reference contigs in a BAM file?

It depends on whether you're using the NCBI/GRC build 36/build 37 version of the human genome, or the UCSC hg18/hg19 version of the human genome. While substantially equivalent, the naming conventions are different. The canonical ordering of contigs for these genomes is as follows:

Human genome reference consortium standard ordering and names (b3x): 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, Y, MT...

UCSC convention (hg1x): chrM, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, chr19, chr20, chr21, chr22, chrX, chrY...

5. How can I tell if my BAM file is sorted properly?

The easiest way to do it is to download Samtools and run the following command to examine the header of your file:

$ samtools view -H /path/to/my.bam
@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:247249719
@SQ     SN:2    LN:242951149
@SQ     SN:3    LN:199501827
@SQ     SN:4    LN:191273063
@SQ     SN:5    LN:180857866
@SQ     SN:6    LN:170899992
@SQ     SN:7    LN:158821424
@SQ     SN:8    LN:146274826
@SQ     SN:9    LN:140273252
@SQ     SN:10   LN:135374737
@SQ     SN:11   LN:134452384
@SQ     SN:12   LN:132349534
@SQ     SN:13   LN:114142980
@SQ     SN:14   LN:106368585
@SQ     SN:15   LN:100338915
@SQ     SN:16   LN:88827254
@SQ     SN:17   LN:78774742
@SQ     SN:18   LN:76117153
@SQ     SN:19   LN:63811651
@SQ     SN:20   LN:62435964
@SQ     SN:21   LN:46944323
@SQ     SN:22   LN:49691432
@SQ     SN:X    LN:154913754
@SQ     SN:Y    LN:57772954
@SQ     SN:MT   LN:16571
@SQ     SN:NT_113887    LN:3994

If the order of the contigs here matches the contig ordering specified above, and the SO:coordinate flag appears in your header, then your contig and read ordering satisfies the GATK requirements.

6. My BAM file isn't sorted that way. How can I fix it?

Picard offers a tool called SortSam that will sort a BAM file properly. A similar utility exists in Samtools, but we recommend the Picard tool because SortSam will also set a flag in the header that specifies that the file is correctly sorted, and this flag is necessary for the GATK to know it is safe to process the data. Also, you can use the ReorderSam command to make a BAM file SQ order match another reference sequence.

7. How can I tell if my BAM file has read group and sample information?

A quick Unix command using Samtools will do the trick:

$ samtools view -H /path/to/my.bam | grep '^@RG'
@RG ID:0    PL:solid    PU:Solid0044_20080829_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP   LB:Lib1 PI:2750 DT:2008-08-28T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:1    PL:solid    PU:0083_BCM_20080719_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP    LB:Lib1 PI:2750 DT:2008-07-18T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:2    PL:LS454    PU:R_2008_10_02_06_06_12_FLX01080312_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:3    PL:LS454    PU:R_2008_10_02_06_07_08_rig19_retry    LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:4    PL:LS454    PU:R_2008_10_02_17_50_32_FLX03080339_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC

The presence of the @RG tags indicate the presence of read groups. Each read group has a SM tag, indicating the sample from which the reads belonging to that read group originate.

In addition to the presence of a read group in the header, each read must belong to one and only one read group. Given the following example reads,

$ samtools view /path/to/my.bam | grep '^@RG'
EAS139_44:2:61:681:18781    35  1   1   0   51M =   9   59  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA B<>;==?=?<==?=?=>>?>><=<?=?8<=?>?<:=?>?<==?=>:;<?:= RG:Z:4  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_44:7:84:1300:7601    35  1   1   0   51M =   12  62  TAACCCTAAGCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA G<>;==?=?&=>?=?<==?>?<>>?=?<==?>?<==?>?1==@>?;<=><; RG:Z:3  MF:i:18 Aq:i:0  NM:i:1  UQ:i:5  H0:i:0  H1:i:85
EAS139_44:8:59:118:13881    35  1   1   0   51M =   2   52  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>;<=?=?==>?>?<==?=><=>?-?;=>?:><==?7?;<>?5?<<=>:; RG:Z:1  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_46:3:75:1326:2391    35  1   1   0   51M =   12  62  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>==>?>@???B>A>?>A?A>??A?@>?@A?@;??A>@7>?>>@:>=@;@ RG:Z:0  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31

membership in a read group is specified by the RG:Z:* tag. For instance, the first read belongs to read group 4 (sample NA11881), while the last read shown here belongs to read group 0 (sample NA12414).

8. My BAM file doesn't have read group and sample information. Do I really need it?

Yes! Many algorithms in the GATK need to know that certain reads were sequenced together on a specific lane, as they attempt to compensate for variability from one sequencing run to the next. Others need to know that the data represents not just one, but many samples. Without the read group and sample information, the GATK has no way of determining this critical information.

9. What's the meaning of the standard read group fields?

For technical details, see the SAM specification on the Samtools website.

Tag Importance SAM spec definition Meaning
ID Required Read group identifier. Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section. Read groupIDs may be modified when merging SAM files in order to handle collisions. Ideally, this should be a globally unique identify across all sequencing data in the world, such as the Illumina flowcell + lane name and number. Will be referenced by each read with the RG:Z field, allowing tools to determine the read group information associated with each read, including the sample from which the read came. Also, a read group is effectively treated as a separate run of the NGS instrument in tools like base quality score recalibration -- all reads within a read group are assumed to come from the same instrument run and to therefore share the same error model.
SM Sample. Use pool name where a pool is being sequenced. Required. As important as ID. The name of the sample sequenced in this read group. GATK tools treat all read groups with the same SM value as containing sequencing data for the same sample. Therefore it's critical that the SM field be correctly specified, especially when using multi-sample tools like the Unified Genotyper.
PL Platform/technology used to produce the read. Valid values: ILLUMINA, SOLID, LS454, HELICOS and PACBIO. Important. Not currently used in the GATK, but was in the past, and may return. The only way to known the sequencing technology used to generate the sequencing data . It's a good idea to use this field.
LB DNA preparation library identify Essential for MarkDuplicates MarkDuplicates uses the LB field to determine which read groups might contain molecular duplicates, in case the same DNA library was sequenced on multiple lanes.

We do not require value for the CN, DS, DT, PG, PI, or PU fields.

A concrete example may be instructive. Suppose I have a trio of samples: MOM, DAD, and KID. Each has two DNA libraries prepared, one with 400 bp inserts and another with 200 bp inserts. Each of these libraries is run on two lanes of an Illumina HiSeq, requiring 3 x 2 x 2 = 12 lanes of data. When the data come off the sequencer, I would create 12 bam files, with the following @RG fields in the header:

Dad's data:

Mom's data:

Kid's data:

Note the hierarchical relationship between read groups (unique for each lane) to libraries (sequenced on two lanes) and samples (across four lanes, two lanes for each library).

9. My BAM file doesn't have read group and sample information. How do I add it?

Use Picard's AddOrReplaceReadGroups tool to add read group information.

10. How do I know if my BAM file is valid?

Picard contains a tool called ValidateSamFile that can be used for this. BAMs passing STRICT validation stringency work best with the GATK.

11. What's the best way to create a subset of my BAM file containing only reads over a small interval?

You can use the GATK to do the following:

GATK -I full.bam -T PrintReads -L chr1:10-20 -o subset.bam

and you'll get a BAM file containing only reads overlapping those points. This operation retains the complete BAM header from the full file (this was the reference aligned to, after all) so that the BAM remains easy to work with. We routinely use these features for testing and high-performance analysis with the GATK.

Comments (77)

This document describes "regular" (variants-only) VCF files. For information on the gVCF format produced by HaplotypeCaller in -ERC GVCF mode, please see this companion document.

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence indicated by GQ = 25.92 isn't so good, largely because there were only a total of 4 reads at this site (DP =4), 1 of which was REF (=had the reference base) and 3 of which were ALT (=had the alternate base) (indicated by AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value that corresponds to a likelihood of 1.0). There's a chance that the subject is "hom-var" (=homozygous with the variant allele) since PL(1/1) = 26, which corresponds to 10^(-2.6), or 0.0025, but either way, it's clear that the subject is definitely not "hom-ref" (=homozygous with the reference allele) since PL(0/0) = 103, which corresponds to 10^(-10.3), a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Pre-processing Overview

When you receive sequence data from your sequencing provider (whether it is an in-house service or a commercial company), the data is typically in a raw state (one or several FASTQ files) that is not immediately usable for analysis with the GATK. Even if you receive a BAM file (i.e. a file in which the reads have been aligned to a reference genome) you still need to apply some processing steps to your data to make it suitable for variant calling analysis. This section describes the pre-processing steps that are necessary in order to prepare your data for analysis, starting with FASTQ files and ending in an analysis-ready BAM file.

The steps involved are:

  1. Mapping and Marking Duplicates
  2. Local Realignment Around Indels
  3. Base Quality Score Recalibration (BQSR)

These steps should be performed in the order shown above. Please note that although Indel Realignment and Base Recalibration represent significant costs in terms of computational resources and runtime, we assure you that the investment will pay off with significant increases in the quality of your results.

Frequently Asked Questions

Comments (0)

There are four major organizational units for next-generation DNA sequencing processes that used throughout the GATK documentation:

  • Lane: The basic machine unit for sequencing. The lane reflects the basic independent run of an NGS machine. For Illumina machines, this is the physical sequencing lane.

  • Library: A unit of DNA preparation that at some point is physically pooled together. Multiple lanes can be run from aliquots from the same library. The DNA library and its preparation is the natural unit that is being sequenced. For example, if the library has limited complexity, then many sequences are duplicated and will result in a high duplication rate across lanes.

  • Sample: A single individual, such as human CEPH NA12878. Multiple libraries with different properties can be constructed from the original sample DNA source. Throughout our documentation, we treat samples as independent individuals whose genome sequence we are attempting to determine. Note that from this perspective, tumor / normal samples are different despite coming from the same individual.

  • Cohort: A collection of samples being analyzed together. This organizational unit is the most subjective and depends very specifically on the design goals of the sequencing project. For population discovery projects like the 1000 Genomes, the analysis cohort is the ~100 individual in each population. For exome projects with many deeply sequenced samples (e.g., ESP with 800 EOMI samples) we divide up the complete set of samples into cohorts of ~50 individuals for multi-sample analyses.

Note that many GATK commands can be run at the lane level, but will give better results seeing all of the data for a single sample, or even all of the data for all samples. Unfortunately, there's a trade-off in computational cost, since running these commands across all of your data simultaneously requires much more computing power. Please see the documentation for each step to understand what is the best way to group or partition your data for that particular process.

Comments (12)

Note that there are many possible ways to achieve a similar result; here we present the way we think gives the best combination of efficiency and quality. This assumes that you are dealing with one or more samples, and each of them was sequenced on one or more lanes.

Let's say we have this example data:

  • sample1_lane1.fq
  • sample1_lane2.fq
  • sample2_lane1.fq
  • sample2_lane2.fq

1. Run all core steps per-lane once

At the basic level, all pre-processing steps are meant to be performed per-lane. Assuming that you received one FASTQ file per lane of sequence data, just run each file through each pre-processing step individually: map & dedup -> realign -> recal.

The example data becomes:

  • sample1_lane1.dedup.realn.recal.bam
  • sample1_lane2.dedup.realn.recal.bam
  • sample2_lane1.dedup.realn.recal.bam
  • sample2_lane2.dedup.realn.recal.bam

2. Merge lanes per sample

Once you have pre-processed each lane individually, you merge lanes belonging to the same sample into a single BAM file.

The example data becomes:

  • sample1.merged.bam
  • sample2.merged.bam

3. Per-sample refinement

You can increase the quality of your results by performing an extra round of dedupping and realignment, this time at the sample level. It is not absolutely required and will increase your computational costs, so it's up to you to decide whether you want to do it on your data, but that's how we do it internally at Broad.

The example data becomes:

  • sample1.merged.dedup.realn.bam
  • sample2.merged.dedup.realn.bam

This gets you two big wins:

  • Dedupping per-sample eliminates PCR duplicates across all lanes in addition to optical duplicates (which are by definition only per-lane)
  • Realigning per-sample means that you will have consistent alignments across all lanes within a sample.

People often ask also if it's worth the trouble to try realigning across all samples in a cohort. The answer is almost always no, unless you have very shallow coverage. The problem is that while it would be lovely to ensure consistent alignments around indels across all samples, the computational cost gets too ridiculous too fast. That being said, for contrastive calling projects -- such as cancer tumor/normals -- we do recommend realigning both the tumor and the normal together in general to avoid slight alignment differences between the two tissue types.

Finally, why not do base recalibration across lanes or across samples? Well, by definition there is no sense in trying to recalibrate across lanes, since the purpose of this processing step is to compensate for the errors made by the machine during sequencing, and the lane is the base unit of the sequencing machine. That said, don't worry if you find yourself needing to recalibrate a BAM file with the lanes already merged -- the GATK's BaseRecalibrator is read group-aware, which means that it will identify separate lanes as such even if they are in the same BAM file, and it will always process them separately.

Comments (15)

1. What file formats do you support for sequencer output?

The GATK supports the BAM format for reads, quality scores, alignments, and metadata (e.g. the lane of sequencing, center of origin, sample name, etc.). No other file formats are supported.

2. How do I get my data into BAM format?

The GATK doesn't have any tools for getting data into BAM format, but many other toolkits exist for this purpose. We recommend you look at Picard and Samtools for creating and manipulating BAM files. Also, many aligners are starting to emit BAM files directly. See BWA for one such aligner.

3. What are the formatting requirements for my BAM file(s)?

All BAM files must satisfy the following requirements:

  • It must be aligned to one of the references described here.
  • It must be sorted in coordinate order (not by queryname and not "unsorted").
  • It must list the read groups with sample names in the header.
  • Every read must belong to a read group.
  • The BAM file must pass Picard validation.

See the BAM specification for more information.

4. What is the canonical ordering of human reference contigs in a BAM file?

It depends on whether you're using the NCBI/GRC build 36/build 37 version of the human genome, or the UCSC hg18/hg19 version of the human genome. While substantially equivalent, the naming conventions are different. The canonical ordering of contigs for these genomes is as follows:

Human genome reference consortium standard ordering and names (b3x): 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, Y, MT...

UCSC convention (hg1x): chrM, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, chr19, chr20, chr21, chr22, chrX, chrY...

5. How can I tell if my BAM file is sorted properly?

The easiest way to do it is to download Samtools and run the following command to examine the header of your file:

$ samtools view -H /path/to/my.bam
@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:247249719
@SQ     SN:2    LN:242951149
@SQ     SN:3    LN:199501827
@SQ     SN:4    LN:191273063
@SQ     SN:5    LN:180857866
@SQ     SN:6    LN:170899992
@SQ     SN:7    LN:158821424
@SQ     SN:8    LN:146274826
@SQ     SN:9    LN:140273252
@SQ     SN:10   LN:135374737
@SQ     SN:11   LN:134452384
@SQ     SN:12   LN:132349534
@SQ     SN:13   LN:114142980
@SQ     SN:14   LN:106368585
@SQ     SN:15   LN:100338915
@SQ     SN:16   LN:88827254
@SQ     SN:17   LN:78774742
@SQ     SN:18   LN:76117153
@SQ     SN:19   LN:63811651
@SQ     SN:20   LN:62435964
@SQ     SN:21   LN:46944323
@SQ     SN:22   LN:49691432
@SQ     SN:X    LN:154913754
@SQ     SN:Y    LN:57772954
@SQ     SN:MT   LN:16571
@SQ     SN:NT_113887    LN:3994

If the order of the contigs here matches the contig ordering specified above, and the SO:coordinate flag appears in your header, then your contig and read ordering satisfies the GATK requirements.

6. My BAM file isn't sorted that way. How can I fix it?

Picard offers a tool called SortSam that will sort a BAM file properly. A similar utility exists in Samtools, but we recommend the Picard tool because SortSam will also set a flag in the header that specifies that the file is correctly sorted, and this flag is necessary for the GATK to know it is safe to process the data. Also, you can use the ReorderSam command to make a BAM file SQ order match another reference sequence.

7. How can I tell if my BAM file has read group and sample information?

A quick Unix command using Samtools will do the trick:

$ samtools view -H /path/to/my.bam | grep '^@RG'
@RG ID:0    PL:solid    PU:Solid0044_20080829_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP   LB:Lib1 PI:2750 DT:2008-08-28T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:1    PL:solid    PU:0083_BCM_20080719_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP    LB:Lib1 PI:2750 DT:2008-07-18T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:2    PL:LS454    PU:R_2008_10_02_06_06_12_FLX01080312_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:3    PL:LS454    PU:R_2008_10_02_06_07_08_rig19_retry    LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:4    PL:LS454    PU:R_2008_10_02_17_50_32_FLX03080339_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC

The presence of the @RG tags indicate the presence of read groups. Each read group has a SM tag, indicating the sample from which the reads belonging to that read group originate.

In addition to the presence of a read group in the header, each read must belong to one and only one read group. Given the following example reads,

$ samtools view /path/to/my.bam | grep '^@RG'
EAS139_44:2:61:681:18781    35  1   1   0   51M =   9   59  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA B<>;==?=?<==?=?=>>?>><=<?=?8<=?>?<:=?>?<==?=>:;<?:= RG:Z:4  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_44:7:84:1300:7601    35  1   1   0   51M =   12  62  TAACCCTAAGCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA G<>;==?=?&=>?=?<==?>?<>>?=?<==?>?<==?>?1==@>?;<=><; RG:Z:3  MF:i:18 Aq:i:0  NM:i:1  UQ:i:5  H0:i:0  H1:i:85
EAS139_44:8:59:118:13881    35  1   1   0   51M =   2   52  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>;<=?=?==>?>?<==?=><=>?-?;=>?:><==?7?;<>?5?<<=>:; RG:Z:1  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_46:3:75:1326:2391    35  1   1   0   51M =   12  62  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>==>?>@???B>A>?>A?A>??A?@>?@A?@;??A>@7>?>>@:>=@;@ RG:Z:0  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31

membership in a read group is specified by the RG:Z:* tag. For instance, the first read belongs to read group 4 (sample NA11881), while the last read shown here belongs to read group 0 (sample NA12414).

8. My BAM file doesn't have read group and sample information. Do I really need it?

Yes! Many algorithms in the GATK need to know that certain reads were sequenced together on a specific lane, as they attempt to compensate for variability from one sequencing run to the next. Others need to know that the data represents not just one, but many samples. Without the read group and sample information, the GATK has no way of determining this critical information.

9. What's the meaning of the standard read group fields?

For technical details, see the SAM specification on the Samtools website.

Tag Importance SAM spec definition Meaning
ID Required Read group identifier. Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section. Read groupIDs may be modified when merging SAM files in order to handle collisions. Ideally, this should be a globally unique identify across all sequencing data in the world, such as the Illumina flowcell + lane name and number. Will be referenced by each read with the RG:Z field, allowing tools to determine the read group information associated with each read, including the sample from which the read came. Also, a read group is effectively treated as a separate run of the NGS instrument in tools like base quality score recalibration -- all reads within a read group are assumed to come from the same instrument run and to therefore share the same error model.
SM Sample. Use pool name where a pool is being sequenced. Required. As important as ID. The name of the sample sequenced in this read group. GATK tools treat all read groups with the same SM value as containing sequencing data for the same sample. Therefore it's critical that the SM field be correctly specified, especially when using multi-sample tools like the Unified Genotyper.
PL Platform/technology used to produce the read. Valid values: ILLUMINA, SOLID, LS454, HELICOS and PACBIO. Important. Not currently used in the GATK, but was in the past, and may return. The only way to known the sequencing technology used to generate the sequencing data . It's a good idea to use this field.
LB DNA preparation library identify Essential for MarkDuplicates MarkDuplicates uses the LB field to determine which read groups might contain molecular duplicates, in case the same DNA library was sequenced on multiple lanes.

We do not require value for the CN, DS, DT, PG, PI, or PU fields.

A concrete example may be instructive. Suppose I have a trio of samples: MOM, DAD, and KID. Each has two DNA libraries prepared, one with 400 bp inserts and another with 200 bp inserts. Each of these libraries is run on two lanes of an Illumina HiSeq, requiring 3 x 2 x 2 = 12 lanes of data. When the data come off the sequencer, I would create 12 bam files, with the following @RG fields in the header:

Dad's data:

Mom's data:

Kid's data:

Note the hierarchical relationship between read groups (unique for each lane) to libraries (sequenced on two lanes) and samples (across four lanes, two lanes for each library).

9. My BAM file doesn't have read group and sample information. How do I add it?

Use Picard's AddOrReplaceReadGroups tool to add read group information.

10. How do I know if my BAM file is valid?

Picard contains a tool called ValidateSamFile that can be used for this. BAMs passing STRICT validation stringency work best with the GATK.

11. What's the best way to create a subset of my BAM file containing only reads over a small interval?

You can use the GATK to do the following:

GATK -I full.bam -T PrintReads -L chr1:10-20 -o subset.bam

and you'll get a BAM file containing only reads overlapping those points. This operation retains the complete BAM header from the full file (this was the reference aligned to, after all) so that the BAM remains easy to work with. We routinely use these features for testing and high-performance analysis with the GATK.

Comments (77)

This document describes "regular" (variants-only) VCF files. For information on the gVCF format produced by HaplotypeCaller in -ERC GVCF mode, please see this companion document.

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence indicated by GQ = 25.92 isn't so good, largely because there were only a total of 4 reads at this site (DP =4), 1 of which was REF (=had the reference base) and 3 of which were ALT (=had the alternate base) (indicated by AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value that corresponds to a likelihood of 1.0). There's a chance that the subject is "hom-var" (=homozygous with the variant allele) since PL(1/1) = 26, which corresponds to 10^(-2.6), or 0.0025, but either way, it's clear that the subject is definitely not "hom-ref" (=homozygous with the reference allele) since PL(0/0) = 103, which corresponds to 10^(-10.3), a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Mapping and Marking Duplicates

The Best Practices variant discovery workflow depends on having sequence data in the form of reads that are aligned to a reference genome. So the very first step is of course to map your reads to the reference to produce a file in SAM/BAM format. We recommend using BWA, but depending on your data and how it was sequenced, you may need to use a different aligner. Once you have mapped the reads, you'll need to make sure they are sorted in the proper order (by coordinate).

Then you can proceed to mark duplicates. The rationale here is that during the sequencing process, the same DNA molecules can be sequenced several times. The resulting duplicate reads are not informative and should not be counted as additional evidence for or against a putative variant. The duplicate marking process (sometimes called **dedupping** in bioinformatics slang) identifies these reads as such so that the GATK tools know they should ignore them.

These steps are performed with tools such as Samtools and Picard that are not part of GATK, so we don't provide detailed documentation of all the options available. For more details, please see those tools' respective documentations.


Comments (15)


Map the read data to the reference and mark duplicates.


  • TBD


  1. Identify read group information
  2. Generate a SAM file containing aligned reads
  3. Convert to BAM, sort and mark duplicates

1. Identify read group information

The read group information is key for downstream GATK functionality. The GATK will not work without a read group tag. Make sure to enter as much metadata as you know about your data in the read group fields provided. For more information about all the possible fields in the @RG tag, take a look at the SAM specification.


Compose the read group identifier in the following format:


where the \t stands for the tab character.

2. Generate a SAM file containing aligned reads


Run the following BWA command:

In this command, replace read group info by the read group identifier composed in the previous step.

bwa mem -M -R ’<read group info>’ -p reference.fa raw_reads.fq > aligned_reads.sam 

replacing the <read group info> bit with the read group identifier you composed at the previous step.

The -M flag causes BWA to mark shorter split hits as secondary (essential for Picard compatibility).

Expected Result

This creates a file called aligned_reads.sam containing the aligned reads from all input files, combined, annotated and aligned to the same reference.

Note that here we are using a command that is specific for pair ended data in an interleaved fastq file, which is what we are providing to you as a tutorial file. To map other types of datasets (e.g. single-ended or pair-ended in forward/reverse read files) you will need to adapt the command accordingly. Please see the BWA documentation for exact usage and more options for these commands.

3. Convert to BAM, sort and mark duplicates

These initial pre-processing operations format the data to suit the requirements of the GATK tools.


Run the following Picard command to sort the SAM file and convert it to BAM:

java -jar SortSam.jar \ 
    INPUT=aligned_reads.sam \ 
    OUTPUT=sorted_reads.bam \ 

Expected Results

This creates a file called sorted_reads.bam containing the aligned reads sorted by coordinate.


Run the following Picard command to mark duplicates:

java -jar MarkDuplicates.jar \ 
    INPUT=sorted_reads.bam \ 
    OUTPUT=dedup_reads.bam \

Expected Result

This creates a sorted BAM file called dedup_reads.bam with the same content as the input file, except that any duplicate reads are marked as such. It also produces a metrics file called metrics.txt containing (can you guess?) metrics.


Run the following Picard command to index the BAM file:

java -jar BuildBamIndex.jar \ 

Expected Result

This creates an index file for the BAM file called dedup_reads.bai.

Comments (5)


Prepare a reference sequence so that it is suitable for use with BWA and GATK.


  • Installed BWA
  • Installed SAMTools
  • Installed Picard


  1. Generate the BWA index
  2. Generate the Fasta file index
  3. Generate the sequence dictionary

1. Generate the BWA index


Run the following BWA command:

bwa index -a bwtsw reference.fa 

where -a bwtsw specifies that we want to use the indexing algorithm that is capable of handling the whole human genome.

Expected Result

This creates a collection of files used by BWA to perform the alignment.

2. Generate the fasta file index


Run the following SAMtools command:

samtools faidx reference.fa 

Expected Result

This creates a file called reference.fa.fai, with one record per line for each of the contigs in the FASTA reference file. Each record is composed of the contig name, size, location, basesPerLine and bytesPerLine.

3. Generate the sequence dictionary


Run the following Picard command:

java -jar CreateSequenceDictionary.jar \
    REFERENCE=reference.fa \ 

Expected Result

This creates a file called reference.dict formatted like a SAM header, describing the contents of your reference FASTA file.

Comments (2)


Fix a BAM that is not indexed or not sorted, has not had duplicates marked, or is lacking read group information. These steps can be performed independently of each other but this order is recommended.


  • Installed Picard tools


  1. Sort the aligned reads by coordinate order
  2. Mark duplicates
  3. Add read group information
  4. Index the BAM file


You may ask, is all of this really necessary? The GATK is notorious for imposing strict formatting guidelines and requiring the presence of information such as read groups that other software packages do not require. Although this represents a small additional processing burden upfront, the downstream benefits are numerous, including the ability to process library data individually, and significant gains in speed and parallelization options.

1. Sort the aligned reads by coordinate order


Run the following Picard command:

java -jar SortSam.jar \ 
    INPUT=unsorted_reads.bam \ 
    OUTPUT=sorted_reads.bam \ 

Expected Results

This creates a file called sorted_reads.bam containing the aligned reads sorted by coordinate.

2. Mark duplicate reads


Run the following Picard command:

java -jar MarkDuplicates.jar \ 
    INPUT=sorted_reads.bam \ 

Expected Results

This creates a file called dedup_reads.bam with the same content as the input file, except that any duplicate reads are marked as such.

More details

During the sequencing process, the same DNA molecules can be sequenced several times. The resulting duplicate reads are not informative and should not be counted as additional evidence for or against a putative variant. The duplicate marking process (sometimes called dedupping in bioinformatics slang) identifies these reads as such so that the GATK tools know to ignore them.

3. Add read group information


Run the following Picard command:

java -jar AddOrReplaceReadGroups.jar  \ 
    INPUT=dedup_reads.bam \ 
    OUTPUT=addrg_reads.bam \ 
    RGID=group1 RGLB= lib1 RGPL=illumina RGPU=unit1 RGSM=sample1 

Expected Results

This creates a file called addrg_reads.bam with the same content as the input file, except that the reads will now have read group information attached.

4. Index the BAM file


Run the following Picard command:

java -jar BuildBamIndex \ 

Expected Results

This creates an index file called addrg_reads.bai, which is ready to be used in the Best Practices workflow.

Since Picard tools do not systematically create an index file when they output a new BAM file (unlike GATK tools, which will always output indexed files), it is best to keep the indexing step for last.

Comments (11)


Revert a BAM file back to FastQ. This comes in handy when you receive data that has been processed but not according to GATK Best Practices, and you want to reset and reprocess it properly.


  • Installed HTSlib


  1. Shuffle the reads in the bam file
  2. Revert the BAM file to FastQ format
  3. Compress the FastQ file
  4. Note for advanced users

1. Shuffle the reads in the bam file


Shuffle the reads in the bam file so they are not in a biased order before alignment by running the following HTSlib command:

htscmd bamshuf -uOn 128 aln_reads.bam tmp > shuffled_reads.bam 

Expected Result

This creates a new BAM file containing the original reads, which still retain their mapping information, but now they are no longer sorted.

The aligner uses blocks of paired reads to estimate the insert size. If you don’t shuffle your original bam, the blocks of insert size will not be randomly distributed across the genome, rather they will all come from the same region, biasing the insert size calculation. This is a very important step which is unfortunately often overlooked.

2. Revert the BAM file to FastQ


Revert the BAM file to FastQ format by running the following HTSlib command:

htscmd bam2fq -a shuffled_reads.bam > interleaved_reads.fq 

Expected Result

This creates an interleaved FastQ file called interleaved_reads.fq containing the now-unmapped paired reads.

Interleaved simply means that for each pair of reads in your paired-end data set, both the forward and the reverse reads are in the same file, as opposed to having them in separate files.

3. Compress the FastQ file


Compress the FastQ file to reduce its size using the gzip utility:

gzip interleaved_reads.fq

Expected Result

This creates a gzipped FastQ file called interleaved_reads.fq.gz. This file is ready to be used as input for the Best Practices workflow.

BWA handles gzipped fastq files natively, so you don’t need to unzip the file to use it later on.

4. Note for advanced users

If you’re feeling adventurous, you can do all of the above with this beautiful one-liner, which will save you a heap of time that the program would otherwise spend performing I/O (loading in and writing out data to/from disk):

htscmd bamshuf -uOn 128 aln_reads.bam tmp | htscmd bam2fq -a - | gzip > interleaved_reads.fq.gz 

Frequently Asked Questions

Comments (15)

This article describes the steps necessary to prepare your reference file (if it's not one that you got from us). As a complement to this article, see the relevant tutorial.

Why these steps are necessary

The GATK uses two files to access and safety check access to the reference files: a .dict dictionary of the contig names and sizes and a .fai fasta index file to allow efficient random access to the reference bases. You have to generate these files in order to be able to use a Fasta file as reference.

NOTE: Picard and samtools treat spaces in contig names differently. We recommend that you avoid using spaces in contig names.

Creating the fasta sequence dictionary file

We use CreateSequenceDictionary.jar from Picard to create a .dict file from a fasta file.

> java -jar CreateSequenceDictionary.jar R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:11 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict
[Fri Jun 19 14:09:58 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary done.
44.922u 2.308s 0:47.09 100.2%   0+0k 0+0io 2pf+0w

This produces a SAM-style header file describing the contents of our fasta file.

> cat Homo_sapiens_assembly18.dict 
@HD     VN:1.0  SO:unsorted
@SQ     SN:chrM LN:16571        UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d2ed829b8a1628d16cbeee88e88e39eb
@SQ     SN:chr1 LN:247249719    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9ebc6df9496613f373e73396d5b3b6b6
@SQ     SN:chr2 LN:242951149    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:b12c7373e3882120332983be99aeb18d
@SQ     SN:chr3 LN:199501827    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0e48ed7f305877f66e6fd4addbae2b9a
@SQ     SN:chr4 LN:191273063    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cf37020337904229dca8401907b626c2
@SQ     SN:chr5 LN:180857866    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:031c851664e31b2c17337fd6f9004858
@SQ     SN:chr6 LN:170899992    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfe8005c536131276d448ead33f1b583
@SQ     SN:chr7 LN:158821424    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:74239c5ceee3b28f0038123d958114cb
@SQ     SN:chr8 LN:146274826    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1eb00fe1ce26ce6701d2cd75c35b5ccb
@SQ     SN:chr9 LN:140273252    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:ea244473e525dde0393d353ef94f974b
@SQ     SN:chr10        LN:135374737    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4ca41bf2d7d33578d2cd7ee9411e1533
@SQ     SN:chr11        LN:134452384    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:425ba5eb6c95b60bafbf2874493a56c3
@SQ     SN:chr12        LN:132349534    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d17d70060c56b4578fa570117bf19716
@SQ     SN:chr13        LN:114142980    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c4f3084a20380a373bbbdb9ae30da587
@SQ     SN:chr14        LN:106368585    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:c1ff5d44683831e9c7c1db23f93fbb45
@SQ     SN:chr15        LN:100338915    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:5cd9622c459fe0a276b27f6ac06116d8
@SQ     SN:chr16        LN:88827254     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3e81884229e8dc6b7f258169ec8da246
@SQ     SN:chr17        LN:78774742     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2a5c95ed99c5298bb107f313c7044588
@SQ     SN:chr18        LN:76117153     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:3d11df432bcdc1407835d5ef2ce62634
@SQ     SN:chr19        LN:63811651     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2f1a59077cfad51df907ac25723bff28
@SQ     SN:chr20        LN:62435964     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f126cdf8a6e0c7f379d618ff66beb2da
@SQ     SN:chr21        LN:46944323     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f1b74b7f9f4cdbaeb6832ee86cb426c6
@SQ     SN:chr22        LN:49691432     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:2041e6a0c914b48dd537922cca63acb8
@SQ     SN:chrX LN:154913754    UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d7e626c80ad172a4d7c95aadb94d9040
@SQ     SN:chrY LN:57772954     UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:62f69d0e82a12af74bad85e2e4a8bd91
@SQ     SN:chr1_random  LN:1663265      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:cc05cb1554258add2eb62e88c0746394
@SQ     SN:chr2_random  LN:185571       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:18ceab9e4667a25c8a1f67869a4356ea
@SQ     SN:chr3_random  LN:749256       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cc571e918ac18afa0b2053262cadab6
@SQ     SN:chr4_random  LN:842648       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:9cab2949ccf26ee0f69a875412c93740
@SQ     SN:chr5_random  LN:143687       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:05926bdbff978d4a0906862eb3f773d0
@SQ     SN:chr6_random  LN:1875562      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:d62eb2919ba7b9c1d382c011c5218094
@SQ     SN:chr7_random  LN:549659       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:28ebfb89c858edbc4d71ff3f83d52231
@SQ     SN:chr8_random  LN:943810       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:0ed5b088d843d6f6e6b181465b9e82ed
@SQ     SN:chr9_random  LN:1146434      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:1e3d2d2f141f0550fa28a8d0ed3fd1cf
@SQ     SN:chr10_random LN:113275       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:50be2d2c6720dabeff497ffb53189daa
@SQ     SN:chr11_random LN:215294       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bfc93adc30c621d5c83eee3f0d841624
@SQ     SN:chr13_random LN:186858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:563531689f3dbd691331fd6c5730a88b
@SQ     SN:chr15_random LN:784346       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:bf885e99940d2d439d83eba791804a48
@SQ     SN:chr16_random LN:105485       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:dd06ea813a80b59d9c626b31faf6ae7f
@SQ     SN:chr17_random LN:2617613      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:34d5e2005dffdfaaced1d34f60ed8fc2
@SQ     SN:chr18_random LN:4262 UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f3814841f1939d3ca19072d9e89f3fd7
@SQ     SN:chr19_random LN:301858       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:420ce95da035386cc8c63094288c49e2
@SQ     SN:chr21_random LN:1679693      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:a7252115bfe5bb5525f34d039eecd096
@SQ     SN:chr22_random LN:257318       UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:4f2d259b82f7647d3b668063cf18378b
@SQ     SN:chrX_random  LN:1719168      UR:file:/humgen/gsa-scr1/depristo/dev/GenomeAnalysisTK/trunk/Homo_sapiens_assembly18.fasta      M5:f4d71e0758986c15e5455bf3e14e5d6f

Creating the fasta index file

We use the faidx command in samtools to prepare the fasta index file. This file describes byte offsets in the fasta file for each contig, allowing us to compute exactly where a particular reference base at contig:pos is in the fasta file.

> samtools faidx Homo_sapiens_assembly18.fasta 
108.446u 3.384s 2:44.61 67.9%   0+0k 0+0io 0pf+0w

This produces a text file with one record per line for each of the fasta contigs. Each record is of the: contig, size, location, basesPerLine, bytesPerLine. The index file produced above looks like:

> cat Homo_sapiens_assembly18.fasta.fai 
chrM    16571   6       50      51
chr1    247249719       16915   50      51
chr2    242951149       252211635       50      51
chr3    199501827       500021813       50      51
chr4    191273063       703513683       50      51
chr5    180857866       898612214       50      51
chr6    170899992       1083087244      50      51
chr7    158821424       1257405242      50      51
chr8    146274826       1419403101      50      51
chr9    140273252       1568603430      50      51
chr10   135374737       1711682155      50      51
chr11   134452384       1849764394      50      51
chr12   132349534       1986905833      50      51
chr13   114142980       2121902365      50      51
chr14   106368585       2238328212      50      51
chr15   100338915       2346824176      50      51
chr16   88827254        2449169877      50      51
chr17   78774742        2539773684      50      51
chr18   76117153        2620123928      50      51
chr19   63811651        2697763432      50      51
chr20   62435964        2762851324      50      51
chr21   46944323        2826536015      50      51
chr22   49691432        2874419232      50      51
chrX    154913754       2925104499      50      51
chrY    57772954        3083116535      50      51
chr1_random     1663265 3142044962      50      51
chr2_random     185571  3143741506      50      51
chr3_random     749256  3143930802      50      51
chr4_random     842648  3144695057      50      51
chr5_random     143687  3145554571      50      51
chr6_random     1875562 3145701145      50      51
chr7_random     549659  3147614232      50      51
chr8_random     943810  3148174898      50      51
chr9_random     1146434 3149137598      50      51
chr10_random    113275  3150306975      50      51
chr11_random    215294  3150422530      50      51
chr13_random    186858  3150642144      50      51
chr15_random    784346  3150832754      50      51
chr16_random    105485  3151632801      50      51
chr17_random    2617613 3151740410      50      51
chr18_random    4262    3154410390      50      51
chr19_random    301858  3154414752      50      51
chr21_random    1679693 3154722662      50      51
chr22_random    257318  3156435963      50      51
chrX_random     1719168 3156698441      50      51
Comments (15)

1. What file formats do you support for sequencer output?

The GATK supports the BAM format for reads, quality scores, alignments, and metadata (e.g. the lane of sequencing, center of origin, sample name, etc.). No other file formats are supported.

2. How do I get my data into BAM format?

The GATK doesn't have any tools for getting data into BAM format, but many other toolkits exist for this purpose. We recommend you look at Picard and Samtools for creating and manipulating BAM files. Also, many aligners are starting to emit BAM files directly. See BWA for one such aligner.

3. What are the formatting requirements for my BAM file(s)?

All BAM files must satisfy the following requirements:

  • It must be aligned to one of the references described here.
  • It must be sorted in coordinate order (not by queryname and not "unsorted").
  • It must list the read groups with sample names in the header.
  • Every read must belong to a read group.
  • The BAM file must pass Picard validation.

See the BAM specification for more information.

4. What is the canonical ordering of human reference contigs in a BAM file?

It depends on whether you're using the NCBI/GRC build 36/build 37 version of the human genome, or the UCSC hg18/hg19 version of the human genome. While substantially equivalent, the naming conventions are different. The canonical ordering of contigs for these genomes is as follows:

Human genome reference consortium standard ordering and names (b3x): 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, Y, MT...

UCSC convention (hg1x): chrM, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, chr19, chr20, chr21, chr22, chrX, chrY...

5. How can I tell if my BAM file is sorted properly?

The easiest way to do it is to download Samtools and run the following command to examine the header of your file:

$ samtools view -H /path/to/my.bam
@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:247249719
@SQ     SN:2    LN:242951149
@SQ     SN:3    LN:199501827
@SQ     SN:4    LN:191273063
@SQ     SN:5    LN:180857866
@SQ     SN:6    LN:170899992
@SQ     SN:7    LN:158821424
@SQ     SN:8    LN:146274826
@SQ     SN:9    LN:140273252
@SQ     SN:10   LN:135374737
@SQ     SN:11   LN:134452384
@SQ     SN:12   LN:132349534
@SQ     SN:13   LN:114142980
@SQ     SN:14   LN:106368585
@SQ     SN:15   LN:100338915
@SQ     SN:16   LN:88827254
@SQ     SN:17   LN:78774742
@SQ     SN:18   LN:76117153
@SQ     SN:19   LN:63811651
@SQ     SN:20   LN:62435964
@SQ     SN:21   LN:46944323
@SQ     SN:22   LN:49691432
@SQ     SN:X    LN:154913754
@SQ     SN:Y    LN:57772954
@SQ     SN:MT   LN:16571
@SQ     SN:NT_113887    LN:3994

If the order of the contigs here matches the contig ordering specified above, and the SO:coordinate flag appears in your header, then your contig and read ordering satisfies the GATK requirements.

6. My BAM file isn't sorted that way. How can I fix it?

Picard offers a tool called SortSam that will sort a BAM file properly. A similar utility exists in Samtools, but we recommend the Picard tool because SortSam will also set a flag in the header that specifies that the file is correctly sorted, and this flag is necessary for the GATK to know it is safe to process the data. Also, you can use the ReorderSam command to make a BAM file SQ order match another reference sequence.

7. How can I tell if my BAM file has read group and sample information?

A quick Unix command using Samtools will do the trick:

$ samtools view -H /path/to/my.bam | grep '^@RG'
@RG ID:0    PL:solid    PU:Solid0044_20080829_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP   LB:Lib1 PI:2750 DT:2008-08-28T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:1    PL:solid    PU:0083_BCM_20080719_1_Pilot1_Ceph_12414_B_lib_1_2Kb_MP_Pilot1_Ceph_12414_B_lib_1_2Kb_MP    LB:Lib1 PI:2750 DT:2008-07-18T20:00:00-0400 SM:NA12414  CN:bcm
@RG ID:2    PL:LS454    PU:R_2008_10_02_06_06_12_FLX01080312_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:3    PL:LS454    PU:R_2008_10_02_06_07_08_rig19_retry    LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC
@RG ID:4    PL:LS454    PU:R_2008_10_02_17_50_32_FLX03080339_retry  LB:HL#01_NA11881    PI:0    SM:NA11881  CN:454MSC

The presence of the @RG tags indicate the presence of read groups. Each read group has a SM tag, indicating the sample from which the reads belonging to that read group originate.

In addition to the presence of a read group in the header, each read must belong to one and only one read group. Given the following example reads,

$ samtools view /path/to/my.bam | grep '^@RG'
EAS139_44:2:61:681:18781    35  1   1   0   51M =   9   59  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA B<>;==?=?<==?=?=>>?>><=<?=?8<=?>?<:=?>?<==?=>:;<?:= RG:Z:4  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_44:7:84:1300:7601    35  1   1   0   51M =   12  62  TAACCCTAAGCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA G<>;==?=?&=>?=?<==?>?<>>?=?<==?>?<==?>?1==@>?;<=><; RG:Z:3  MF:i:18 Aq:i:0  NM:i:1  UQ:i:5  H0:i:0  H1:i:85
EAS139_44:8:59:118:13881    35  1   1   0   51M =   2   52  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>;<=?=?==>?>?<==?=><=>?-?;=>?:><==?7?;<>?5?<<=>:; RG:Z:1  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31
EAS139_46:3:75:1326:2391    35  1   1   0   51M =   12  62  TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA @<>==>?>@???B>A>?>A?A>??A?@>?@A?@;??A>@7>?>>@:>=@;@ RG:Z:0  MF:i:18 Aq:i:0  NM:i:0  UQ:i:0  H0:i:85 H1:i:31

membership in a read group is specified by the RG:Z:* tag. For instance, the first read belongs to read group 4 (sample NA11881), while the last read shown here belongs to read group 0 (sample NA12414).

8. My BAM file doesn't have read group and sample information. Do I really need it?

Yes! Many algorithms in the GATK need to know that certain reads were sequenced together on a specific lane, as they attempt to compensate for variability from one sequencing run to the next. Others need to know that the data represents not just one, but many samples. Without the read group and sample information, the GATK has no way of determining this critical information.

9. What's the meaning of the standard read group fields?

For technical details, see the SAM specification on the Samtools website.

Tag Importance SAM spec definition Meaning
ID Required Read group identifier. Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section. Read groupIDs may be modified when merging SAM files in order to handle collisions. Ideally, this should be a globally unique identify across all sequencing data in the world, such as the Illumina flowcell + lane name and number. Will be referenced by each read with the RG:Z field, allowing tools to determine the read group information associated with each read, including the sample from which the read came. Also, a read group is effectively treated as a separate run of the NGS instrument in tools like base quality score recalibration -- all reads within a read group are assumed to come from the same instrument run and to therefore share the same error model.
SM Sample. Use pool name where a pool is being sequenced. Required. As important as ID. The name of the sample sequenced in this read group. GATK tools treat all read groups with the same SM value as containing sequencing data for the same sample. Therefore it's critical that the SM field be correctly specified, especially when using multi-sample tools like the Unified Genotyper.
PL Platform/technology used to produce the read. Valid values: ILLUMINA, SOLID, LS454, HELICOS and PACBIO. Important. Not currently used in the GATK, but was in the past, and may return. The only way to known the sequencing technology used to generate the sequencing data . It's a good idea to use this field.
LB DNA preparation library identify Essential for MarkDuplicates MarkDuplicates uses the LB field to determine which read groups might contain molecular duplicates, in case the same DNA library was sequenced on multiple lanes.

We do not require value for the CN, DS, DT, PG, PI, or PU fields.

A concrete example may be instructive. Suppose I have a trio of samples: MOM, DAD, and KID. Each has two DNA libraries prepared, one with 400 bp inserts and another with 200 bp inserts. Each of these libraries is run on two lanes of an Illumina HiSeq, requiring 3 x 2 x 2 = 12 lanes of data. When the data come off the sequencer, I would create 12 bam files, with the following @RG fields in the header:

Dad's data:

Mom's data:

Kid's data:

Note the hierarchical relationship between read groups (unique for each lane) to libraries (sequenced on two lanes) and samples (across four lanes, two lanes for each library).

9. My BAM file doesn't have read group and sample information. How do I add it?

Use Picard's AddOrReplaceReadGroups tool to add read group information.

10. How do I know if my BAM file is valid?

Picard contains a tool called ValidateSamFile that can be used for this. BAMs passing STRICT validation stringency work best with the GATK.

11. What's the best way to create a subset of my BAM file containing only reads over a small interval?

You can use the GATK to do the following:

GATK -I full.bam -T PrintReads -L chr1:10-20 -o subset.bam

and you'll get a BAM file containing only reads overlapping those points. This operation retains the complete BAM header from the full file (this was the reference aligned to, after all) so that the BAM remains easy to work with. We routinely use these features for testing and high-performance analysis with the GATK.

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Local Realignment around Indels

The algorithms that are used in the initial mapping step tend to produce various types of artifacts. For example, reads that align on the edges of indels often get mapped with mismatching bases that might look like evidence for SNPs, but are actually mapping artifacts. The realignment process identifies the most consistent placement of the reads relative to the indel in order to clean up these artifacts. It occurs in two steps: first the program identifies intervals that need to be realigned, then in the second step it determines the optimal consensus sequence and performs the actual realignment of reads.


Comments (109)

Realigner Target Creator

For a complete, detailed argument reference, refer to the GATK document page here.

Indel Realigner

For a complete, detailed argument reference, refer to the GATK document page here.

Running the Indel Realigner only at known sites

While we advocate for using the Indel Realigner over an aggregated bam using the full Smith-Waterman alignment algorithm, it will work for just a single lane of sequencing data when run in -knownsOnly mode. Novel sites obviously won't be cleaned up, but the majority of a single individual's short indels will already have been seen in dbSNP and/or 1000 Genomes. One would employ the known-only/lane-level realignment strategy in a large-scale project (e.g. 1000 Genomes) where computation time is severely constrained and limited. We modify the example arguments from above to reflect the command-lines necessary for known-only/lane-level cleaning.

The RealignerTargetCreator step would need to be done just once for a single set of indels; so as long as the set of known indels doesn't change, the output.intervals file from below would never need to be recalculated.

 java -Xmx1g -jar /path/to/GenomeAnalysisTK.jar \
  -T RealignerTargetCreator \
  -R /path/to/reference.fasta \
  -o /path/to/output.intervals \
  -known /path/to/indel_calls.vcf

The IndelRealigner step needs to be run on every bam file.

java -Xmx4g \
  -jar /path/to/GenomeAnalysisTK.jar \
  -I <lane-level.bam> \
  -R <ref.fasta> \
  -T IndelRealigner \
  -targetIntervals <intervalListFromStep1Above.intervals> \
  -o <realignedBam.bam> \
  -known /path/to/indel_calls.vcf
  --consensusDeterminationModel KNOWNS_ONLY \
  -LOD 0.4


Comments (5)


Perform local realignment around indels to correct mapping-related artifacts.


  • TBD


  1. Create a target list of intervals to be realigned
  2. Perform realignment of the target intervals

1. Create a target list of intervals to be realigned


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T RealignerTargetCreator \ 
    -R reference.fa \ 
    -I dedup_reads.bam \ 
    -L 20 \ 
    -known gold_indels.vcf \ 
    -o target_intervals.list 

Expected Result

This creates a file called target_intervals.list containing the list of intervals that the program identified as needing realignment within our target, chromosome 20.

The list of known indel sites (gold_indels.vcf) are used as targets for realignment. Only use it if there is such a list for your organism.

2. Perform realignment of the target intervals


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T IndelRealigner \ 
    -R reference.fa \ 
    -I dedup_reads.bam \ 
    -targetIntervals target_intervals.list \ 
    -known gold_indels.vcf \ 
    -o realigned_reads.bam 

Expected Result

This creates a file called realigned_reads.bam containing all the original reads, but with better local alignments in the regions that were realigned.

Note that here, we didn’t include the -L 20 argument. It's not necessary since the program will only run on the target intervals we are providing.

Frequently Asked Questions

Comments (22)

1. Notes on known sites

Why are they important?

Each tool uses known sites differently, but what is common to all is that they use them to help distinguish true variants from false positives, which is very important to how these tools work. If you don't provide known sites, the statistical analysis of the data will be skewed, which can dramatically affect the sensitivity and reliability of the results.

In the variant calling pipeline, the only tools that do not strictly require known sites are UnifiedGenotyper and HaplotypeCaller.

Human genomes

If you're working on human genomes, you're in luck. We provide sets of known sites in the human genome as part of our resource bundle, and we can give you specific Best Practices recommendations on which sets to use for each tool in the variant calling pipeline. See the next section for details.

Non-human genomes

If you're working on genomes of other organisms, things may be a little harder -- but don't panic, we'll try to help as much as we can. We've started a community discussion in the forum on What are the standard resources for non-human genomes? in which we hope people with non-human genomics experience will share their knowledge.

And if it turns out that there is as yet no suitable set of known sites for your organisms, here's how to make your own for the purposes of BaseRecalibration: First, do an initial round of SNP calling on your original, unrecalibrated data. Then take the SNPs that you have the highest confidence in and use that set as the database of known SNPs by feeding it as a VCF file to the base quality score recalibrator. Finally, do a real round of SNP calling with the recalibrated data. These steps could be repeated several times until convergence. Good luck!

Some experimentation will be required to figure out the best way to find the highest confidence SNPs for use here. Perhaps one could call variants with several different calling algorithms and take the set intersection. Or perhaps one could do a very strict round of filtering and take only those variants which pass the test.

2. Recommended sets of known sites per tool

Summary table

Tool dbSNP 129 - - dbSNP >132 - - Mills indels - - 1KG indels - - HapMap - - Omni
RealignerTargetCreator X X
IndelRealigner X X
BaseRecalibrator X X X
(UnifiedGenotyper/ HaplotypeCaller) X
VariantRecalibrator X X X X
VariantEval X

RealignerTargetCreator and IndelRealigner

These tools require known indels passed with the -known argument to function properly. We use both the following files:

  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)


This tool requires known SNPs and indels passed with the -knownSites argument to function properly. We use all the following files:

  • The most recent dbSNP release (build ID > 132)
  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)

UnifiedGenotyper / HaplotypeCaller

These tools do NOT require known sites, but if SNPs are provided with the -dbsnp argument they will use them for variant annotation. We use this file:

  • The most recent dbSNP release (build ID > 132)


For VariantRecalibrator, please see the FAQ article on VQSR training sets and arguments.


This tool requires known SNPs passed with the -dbsnp argument to function properly. We use the following file:

  • A version of dbSNP subsetted to only sites discovered in or before dbSNP BuildID 129, which excludes the impact of the 1000 Genomes project and is useful for evaluation of dbSNP rate and Ti/Tv values at novel sites.
Comments (55)

All analyses done with the GATK typically involve several (though not necessarily all) of the following inputs:

  • Reference genome sequence
  • Sequencing reads
  • Intervals of interest
  • Reference-ordered data

This article describes the corresponding file formats that are acceptable for use with the GATK.

1. Reference Genome Sequence

The GATK requires the reference sequence in a single reference sequence in FASTA format, with all contigs in the same file. The GATK requires strict adherence to the FASTA standard. All the standard IUPAC bases are accepted, but keep in mind that non-standard bases (i.e. other than ACGT, such as W for example) will be ignored (i.e. those positions in the genome will be skipped).

Some users have reported having issues with reference files that have been stored or modified on Windows filesystems. The issues manifest as "10" characters (corresponding to encoded newlines) inserted in the sequence, which cause the GATK to quit with an error. If you encounter this issue, you will need to re-download a valid master copy of the reference file, or clean it up yourself.

Gzipped fasta files will not work with the GATK, so please make sure to unzip them first. Please see this article for more information on preparing FASTA reference sequences for use with the GATK.

Important note about human genome reference versions

If you are using human data, your reads must be aligned to one of the official b3x (e.g. b36, b37) or hg1x (e.g. hg18, hg19) references. The contig ordering in the reference you used must exactly match that of one of the official references canonical orderings. These are defined by historical karotyping of largest to smallest chromosomes, followed by the X, Y, and MT for the b3x references; the order is thus 1, 2, 3, ..., 10, 11, 12, ... 20, 21, 22, X, Y, MT. The hg1x references differ in that the chromosome names are prefixed with "chr" and chrM appears first instead of last. The GATK will detect misordered contigs (for example, lexicographically sorted) and throw an error. This draconian approach, though unnecessary technically, ensures that all supplementary data provided with the GATK works correctly. You can use ReorderSam to fix a BAM file aligned to a missorted reference sequence.

Our Best Practice recommendation is that you use a standard GATK reference from the GATK resource bundle.

2. Sequencing Reads

The only input format for sequence reads that the GATK itself supports is the [Sequence Alignment/Map (SAM)] format. See [SAM/BAM] for more details on the SAM/BAM format as well as Samtools and Picard, two complementary sets of utilities for working with SAM/BAM files.

If you don't find the information you need in this section, please see our FAQs on BAM files.

If you are starting out your pipeline with raw reads (typically in FASTQ format) you'll need to make sure that when you map those reads to the reference and produce a BAM file, the resulting BAM file is fully compliant with the GATK requirements. See the Best Practices documentation for detailed instructions on how to do this.

In addition to being in SAM format, we require the following additional constraints in order to use your file with the GATK:

  • The file must be binary (with .bam file extension).
  • The file must be indexed.
  • The file must be sorted in coordinate order with respect to the reference (i.e. the contig ordering in your bam must exactly match that of the reference you are using).
  • The file must have a proper bam header with read groups. Each read group must contain the platform (PL) and sample (SM) tags. For the platform value, we currently support 454, LS454, Illumina, Solid, ABI_Solid, and CG (all case-insensitive).
  • Each read in the file must be associated with exactly one read group.

Below is an example well-formed SAM field header and fields (with @SQ dictionary truncated to show only the first two chromosomes for brevity):

@HD     VN:1.0  GO:none SO:coordinate
@SQ     SN:1    LN:249250621    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:1b22b98cdeb4a9304cb5d48026a85128
@SQ     SN:2    LN:243199373    AS:NCBI37       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:a0d9851da00400dec1098a9255ac712e
@RG     ID:ERR000162    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR000252    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001684    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@RG     ID:ERR001685    PL:ILLUMINA     LB:g1k-sc-NA12776-CEU-1 PI:200  DS:SRP000031    SM:NA12776      CN:SC
@PG     ID:GATK TableRecalibration      VN:v2.2.16      CL:Covariates=[ReadGroupCovariate, QualityScoreCovariate, DinucCovariate, CycleCovariate], use_original_quals=true, defau 
t_read_group=DefaultReadGroup, default_platform=Illumina, force_read_group=null, force_platform=null, solid_recal_mode=SET_Q_ZERO, window_size_nqs=5, homopolymer_nback=7, except on_if_no_tile=false, pQ=5, maxQ=40, smoothing=137       UR:file:/lustre/scratch102/projects/g1k/ref/main_project/human_g1k_v37.fasta    M5:b4eb71ee878d3706246b7c1dbef69299
@PG     ID:bwa  VN:0.5.5
ERR001685.4315085       16      1       9997    25      35M     *       0       0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     ?8:C7ACAABBCBAAB?CCAABBEBA@ACEBBB@?     XT:A:U  XN:i:4    X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001685  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:>>:>2>>>>>>>>>>>>>>>>>>?>>>>??>???>
ERR001689.1165834       117     1       9997    0       *       =       9997    0       CCGATCTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     >7AA<@@C?@?B?B??>9?B??>A?B???BAB??@     RG:Z:ERR001689    OQ:Z:>:<<8<<<><<><><<>7<>>>?>>??>???????
ERR001689.1165834       185     1       9997    25      35M     =       9997    0       CCGATCTCCCTAACCCTAACCCTAACCCTAACCCT     758A:?>>8?=@@>>?;4<>=??@@==??@?==?8     XT:A:U  XN:i:4    SM:i:25 AM:i:0  X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  RG:Z:ERR001689  NM:i:6  MD:Z:0N0N0N0N1A0A28     OQ:Z:;74>7><><><>>>>><:<>>>>>>>>>>>>>>>>
ERR001688.2681347       117     1       9998    0       *       =       9998    0       CGATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG     5@BA@A6B???A?B??>B@B??>B@B??>BAB???     RG:Z:ERR001688    OQ:Z:=>>>><4><<?><??????????????????????       

Note about fixing BAM files with alternative sortings

The GATK requires that the BAM file be sorted in the same order as the reference. Unfortunately, many BAM files have headers that are sorted in some other order -- lexicographical order is a common alternative. To resort the BAM file please use ReorderSam.

3. Intervals of interest

If you don't find the information you need in this section, please see our FAQs on interval lists.

The GATK accept interval files for processing subsets of the genome in Picard-style interval lists. These files typically have an extension such as '.list' or more explicitly,.interval_list`, and look like this:

@HD     VN:1.0  SO:coordinate
@SQ     SN:1    LN:249250621    AS:GRCh37       UR:   M5:1b22b98cdeb4a9304cb5d48026a85128     SP:Homo Sapiens
@SQ     SN:2    LN:243199373    AS:GRCh37       UR:   M5:a0d9851da00400dec1098a9255ac712e     SP:Homo Sapiens
1       30366   30503   +       target_1
1       69089   70010   +       target_2
1       367657  368599  +       target_3
1       621094  622036  +       target_4
1       861320  861395  +       target_5
1       865533  865718  +       target_6

consisting of aSAM-file-like sequence dictionary (the header), and targets in the form of <chr> <start> <stop> + <target_name>. These interval lists are tab-delimited. They are also 1-based (first position in the genome is position 1, not position 0). The easiest way to create such a file is to combine your reference file's sequence dictionary (the file stored alongside the reference fasta file with the .dict extension) and your intervals into one file.

You can also specify a list of intervals formatted as <chr>:<start>-<stop> (one interval per line). No sequence dictionary is necessary. This file format also uses 1-based coordinates.

Finally, we also accept BED style interval lists. Warning: this file format is 0-based for the start coordinates, so coordinates taken from 1-based formats should be offset by 1.

4. Reference Ordered Data (ROD) file formats

The GATK can associate arbitrary reference ordered data (ROD) files with named tracks for all tools. Some tools require specific ROD data files for processing, and developers are free to write tools that access arbitrary data sets using the ROD interface. The general ROD system has the following syntax:

-argumentName:name,type file

Where name is the name in the GATK tool (like "eval" in VariantEval), type is the type of the file, such as VCF or dbSNP, and file is the path to the file containing the ROD data.

The GATK supports several common file formats for reading ROD data:

  • VCF : VCF type, the recommended format for representing variant loci and genotype calls. The GATK will only process valid VCF files; VCFTools provides the official VCF validator. See here for a useful poster detailing the VCF specification.
  • UCSC formated dbSNP : dbSNP type, UCSC dbSNP database output
  • BED : BED type, a general purpose format for representing genomic interval data, useful for masks and other interval outputs. Please note that the bed format is 0-based while most other formats are 1-based.

Note that we no longer support the PED format. See here for converting .ped files to VCF.

If you need additional information on VCF files, please see our FAQs on VCF files here and here.

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Base Quality Score Recalibration

All our variant calling algorithms rely heavily on the quality scores assigned to the individual base calls in each sequence read. These scores are per-base estimates of error emitted by the sequencing machines. Unfortunately the scores produced by the machines are subject to various sources of systematic error, leading to over- or under-estimated base quality scores in the data. Base quality score recalibration is a process in which we apply machine learning to model these errors empirically and adjust the quality scores accordingly. This allows us to get more accurate base qualities, which in turn improves the accuracy of our variant calls. The base recalibration process involves two key steps: first the program builds a model of covariation based on the data and a set of known variants (which you can bootstrap if there is none available for your organism), then it adjusts the base quality scores in the data based on the model.

In addition, there is an optional but highly recommended step that involves building a second model and generating before/after plots to visualize the effects of the recalibration process.


Comments (96)

Detailed information about command line options for BaseRecalibrator can be found here.


The tools in this package recalibrate base quality scores of sequencing-by-synthesis reads in an aligned BAM file. After recalibration, the quality scores in the QUAL field in each read in the output BAM are more accurate in that the reported quality score is closer to its actual probability of mismatching the reference genome. Moreover, the recalibration tool attempts to correct for variation in quality with machine cycle and sequence context, and by doing so provides not only more accurate quality scores but also more widely dispersed ones. The system works on BAM files coming from many sequencing platforms: Illumina, SOLiD, 454, Complete Genomics, Pacific Biosciences, etc.

New with the release of the full version of GATK 2.0 is the ability to recalibrate not only the well-known base quality scores but also base insertion and base deletion quality scores. These are per-base quantities which estimate the probability that the next base in the read was mis-incorporated or mis-deleted (due to slippage, for example). We've found that these new quality scores are very valuable in indel calling algorithms. In particular these new probabilities fit very naturally as the gap penalties in an HMM-based indel calling algorithms. We suspect there are many other fantastic uses for these data.

This process is accomplished by analyzing the covariation among several features of a base. For example:

  • Reported quality score
  • The position within the read
  • The preceding and current nucleotide (sequencing chemistry effect) observed by the sequencing machine

These covariates are then subsequently applied through a piecewise tabular correction to recalibrate the quality scores of all reads in a BAM file.

For example, pre-calibration a file could contain only reported Q25 bases, which seems good. However, it may be that these bases actually mismatch the reference at a 1 in 100 rate, so are actually Q20. These higher-than-empirical quality scores provide false confidence in the base calls. Moreover, as is common with sequencing-by-synthesis machine, base mismatches with the reference occur at the end of the reads more frequently than at the beginning. Also, mismatches are strongly associated with sequencing context, in that the dinucleotide AC is often much lower quality than TG. The recalibration tool will not only correct the average Q inaccuracy (shifting from Q25 to Q20) but identify subsets of high-quality bases by separating the low-quality end of read bases AC bases from the high-quality TG bases at the start of the read. See below for examples of pre and post corrected values.

The system was designed for users to be able to easily add new covariates to the calculations. For users wishing to add their own covariate simply look at for an idea of how to implement the required interface. Each covariate is a Java class which implements the org.broadinstitute.sting.gatk.walkers.recalibration.Covariate interface. Specifically, the class needs to have a getValue method defined which looks at the read and associated sequence context and pulls out the desired information such as machine cycle.

Running the tools


Detailed information about command line options for BaseRecalibrator can be found here.

This GATK processing step walks over all of the reads in my_reads.bam and tabulates data about the following features of the bases:

  • read group the read belongs to
  • assigned quality score
  • machine cycle producing this base
  • current base + previous base (dinucleotide)

For each bin, we count the number of bases within the bin and how often such bases mismatch the reference base, excluding loci known to vary in the population, according to dbSNP. After running over all reads, BaseRecalibrator produces a file called my_reads.recal_data.grp, which contains the data needed to recalibrate reads. The format of this GATK report is described below.

Creating a recalibrated BAM

To create a recalibrated BAM you can use GATK's PrintReads with the engine on-the-fly recalibration capability. Here is a typical command line to do so:

java -jar GenomeAnalysisTK.jar \
   -T PrintReads \
   -R reference.fasta \
   -I input.bam \
   -BQSR recalibration_report.grp \
   -o output.bam

After computing covariates in the initial BAM File, we then walk through the BAM file again and rewrite the quality scores (in the QUAL field) using the data in the recalibration_report.grp file, into a new BAM file.

This step uses the recalibration table data in recalibration_report.grp produced by BaseRecalibration to recalibrate the quality scores in input.bam, and writing out a new BAM file output.bam with recalibrated QUAL field values.

Effectively the new quality score is:

  • the sum of the global difference between reported quality scores and the empirical quality
  • plus the quality bin specific shift
  • plus the cycle x qual and dinucleotide x qual effect

Following recalibration, the read quality scores are much closer to their empirical scores than before. This means they can be used in a statistically robust manner for downstream processing, such as SNP calling. In additional, by accounting for quality changes by cycle and sequence context, we can identify truly high quality bases in the reads, often finding a subset of bases that are Q30 even when no bases were originally labeled as such.

Miscellaneous information

  • The recalibration system is read-group aware. It separates the covariate data by read group in the recalibration_report.grp file (using @RG tags) and PrintReads will apply this data for each read group in the file. We routinely process BAM files with multiple read groups. Please note that the memory requirements scale linearly with the number of read groups in the file, so that files with many read groups could require a significant amount of RAM to store all of the covariate data.
  • A critical determinant of the quality of the recalibation is the number of observed bases and mismatches in each bin. The system will not work well on a small number of aligned reads. We usually expect well in excess of 100M bases from a next-generation DNA sequencer per read group. 1B bases yields significantly better results.
  • Unless your database of variation is so poor and/or variation so common in your organism that most of your mismatches are real snps, you should always perform recalibration on your bam file. For humans, with dbSNP and now 1000 Genomes available, almost all of the mismatches - even in cancer - will be errors, and an accurate error model (essential for downstream analysis) can be ascertained.
  • The recalibrator applies a "yates" correction for low occupancy bins. Rather than inferring the true Q score from # mismatches / # bases we actually infer it from (# mismatches + 1) / (# bases + 2). This deals very nicely with overfitting problems, which has only a minor impact on data sets with billions of bases but is critical to avoid overconfidence in rare bins in sparse data.

Example pre and post recalibration results

  • Recalibration of a lane sequenced at the Broad by an Illumina GA-II in February 2010
  • There is a significant improvement in the accuracy of the base quality scores after applying the GATK recalibration procedure

The output of the BaseRecalibrator

  • A Recalibration report containing all the recalibration information for the data

Note that the BasRecalibrator no longer produces plots; this is now done by the AnalyzeCovariates tool.

The Recalibration Report

The recalibration report is a [GATKReport]( and not only contains the main result of the analysis, but it is also used as an input to all subsequent analyses on the data. The recalibration report contains the following 5 tables:

  • Arguments Table -- a table with all the arguments and its values
  • Quantization Table
  • ReadGroup Table
  • Quality Score Table
  • Covariates Table

Arguments Table

This is the table that contains all the arguments used to run BQSRv2 for this dataset. This is important for the on-the-fly recalibration step to use the same parameters used in the recalibration step (context sizes, covariates, ...).

Example Arguments table:

#:GATKTable:Arguments:Recalibration argument collection values used in this run
Argument                    Value
covariate                   null
default_platform            null
deletions_context_size      6
force_platform              null
insertions_context_size     6

Quantization Table

The GATK offers native support to quantize base qualities. The GATK quantization procedure uses a statistical approach to determine the best binning system that minimizes the error introduced by amalgamating the different qualities present in the specific dataset. When running BQSRv2, a table with the base counts for each base quality is generated and a 'default' quantization table is generated. This table is a required parameter for any other tool in the GATK if you want to quantize your quality scores.

The default behavior (currently) is to use no quantization when performing on-the-fly recalibration. You can override this by using the engine argument -qq. With -qq 0 you don't quantize qualities, or -qq N you recalculate the quantization bins using N bins on the fly. Note that quantization is completely experimental now and we do not recommend using it unless you are a super advanced user.

Example Arguments table:

#:GATKTable:Quantized:Quality quantization map
QualityScore  Count        QuantizedScore
0                     252               0
1                   15972               1
2                  553525               2
3                 2190142               9
4                 5369681               9
9                83645762               9

ReadGroup Table

This table contains the empirical quality scores for each read group, for mismatches insertions and deletions. This is not different from the table used in the old table recalibration walker.

ReadGroup  EventType  EmpiricalQuality  EstimatedQReported  Observations  Errors
SRR032768  D                   40.7476             45.0000    2642683174    222475
SRR032766  D                   40.9072             45.0000    2630282426    213441
SRR032764  D                   40.5931             45.0000    2919572148    254687
SRR032769  D                   40.7448             45.0000    2850110574    240094
SRR032767  D                   40.6820             45.0000    2820040026    241020
SRR032765  D                   40.9034             45.0000    2441035052    198258
SRR032766  M                   23.2573             23.7733    2630282426  12424434
SRR032768  M                   23.0281             23.5366    2642683174  13159514
SRR032769  M                   23.2608             23.6920    2850110574  13451898
SRR032764  M                   23.2302             23.6039    2919572148  13877177
SRR032765  M                   23.0271             23.5527    2441035052  12158144
SRR032767  M                   23.1195             23.5852    2820040026  13750197
SRR032766  I                   41.7198             45.0000    2630282426    177017
SRR032768  I                   41.5682             45.0000    2642683174    184172
SRR032769  I                   41.5828             45.0000    2850110574    197959
SRR032764  I                   41.2958             45.0000    2919572148    216637
SRR032765  I                   41.5546             45.0000    2441035052    170651
SRR032767  I                   41.5192             45.0000    2820040026    198762

Quality Score Table

This table contains the empirical quality scores for each read group and original quality score, for mismatches insertions and deletions. This is not different from the table used in the old table recalibration walker.

ReadGroup  QualityScore  EventType  EmpiricalQuality  Observations  Errors
SRR032767            49  M                   33.7794          9549        3
SRR032769            49  M                   36.9975          5008        0
SRR032764            49  M                   39.2490          8411        0
SRR032766            18  M                   17.7397      16330200   274803
SRR032768            18  M                   17.7922      17707920   294405
SRR032764            45  I                   41.2958    2919572148   216637
SRR032765             6  M                    6.0600       3401801   842765
SRR032769            45  I                   41.5828    2850110574   197959
SRR032764             6  M                    6.0751       4220451  1041946
SRR032767            45  I                   41.5192    2820040026   198762
SRR032769             6  M                    6.3481       5045533  1169748
SRR032768            16  M                   15.7681      12427549   329283
SRR032766            16  M                   15.8173      11799056   309110
SRR032764            16  M                   15.9033      13017244   334343
SRR032769            16  M                   15.8042      13817386   363078

Covariates Table

This table has the empirical qualities for each covariate used in the dataset. The default covariates are cycle and context. In the current implementation, context is of a fixed size (default 6). Each context and each cycle will have an entry on this table stratified by read group and original quality score.

ReadGroup  QualityScore  CovariateValue  CovariateName  EventType  EmpiricalQuality  Observations  Errors
SRR032767            16  TACGGA          Context        M                   14.2139           817      30
SRR032766            16  AACGGA          Context        M                   14.9938          1420      44
SRR032765            16  TACGGA          Context        M                   15.5145           711      19
SRR032768            16  AACGGA          Context        M                   15.0133          1585      49
SRR032764            16  TACGGA          Context        M                   14.5393           710      24
SRR032766            16  GACGGA          Context        M                   17.9746          1379      21
SRR032768            45  CACCTC          Context        I                   40.7907        575849      47
SRR032764            45  TACCTC          Context        I                   43.8286        507088      20
SRR032769            45  TACGGC          Context        D                   38.7536         37525       4
SRR032768            45  GACCTC          Context        I                   46.0724        445275      10
SRR032766            45  CACCTC          Context        I                   41.0696        575664      44
SRR032769            45  TACCTC          Context        I                   43.4821        490491      21
SRR032766            45  CACGGC          Context        D                   45.1471         65424       1
SRR032768            45  GACGGC          Context        D                   45.3980         34657       0
SRR032767            45  TACGGC          Context        D                   42.7663         37814       1
SRR032767            16  AACGGA          Context        M                   15.9371          1647      41
SRR032764            16  GACGGA          Context        M                   18.2642          1273      18
SRR032769            16  CACGGA          Context        M                   13.0801          1442      70
SRR032765            16  GACGGA          Context        M                   15.9934          1271      31


The memory requirements of the recalibrator will vary based on the type of JVM running the application and the number of read groups in the input bam file.

If the application reports 'java.lang.OutOfMemoryError: Java heap space', increase the max heap size provided to the JVM by adding ' -Xmx????m' to the jvm_args variable in, where '????' is the maximum available memory on the processing computer.

I've tried recalibrating my data using a downloaded file, such as NA12878 on 454, and apply the table to any of the chromosome BAM files always fails due to hitting my memory limit. I've tried giving it as much as 15GB but that still isn't enough.

All of our big merged files for 454 are running with -Xmx16000m arguments to the JVM -- it's enough to process all of the files. 32GB might make the 454 runs a lot faster though.

I have a recalibration file calculated over the entire genome (such as for the 1000 genomes trio) but I split my file into pieces (such as by chromosome). Can the recalibration tables safely be applied to the per chromosome BAM files?

Yes they can. The original tables needed to be calculated over the whole genome but they can be applied to each piece of the data set independently.

I'm working on a genome that doesn't really have a good SNP database yet. I'm wondering if it still makes sense to run base quality score recalibration without known SNPs.

The base quality score recalibrator treats every reference mismatch as indicative of machine error. True polymorphisms are legitimate mismatches to the reference and shouldn't be counted against the quality of a base. We use a database of known polymorphisms to skip over most polymorphic sites. Unfortunately without this information the data becomes almost completely unusable since the quality of the bases will be inferred to be much much lower than it actually is as a result of the reference-mismatching SNP sites.

However, all is not lost if you are willing to experiment a bit. You can bootstrap a database of known SNPs. Here's how it works:

  • First do an initial round of SNP calling on your original, unrecalibrated data.
  • Then take the SNPs that you have the highest confidence in and use that set as the database of known SNPs by feeding it as a VCF file to the base quality score recalibrator.
  • Finally, do a real round of SNP calling with the recalibrated data. These steps could be repeated several times until convergence.

Downsampling to reduce run time

For users concerned about run time please note this small analysis below showing the approximate number of reads per read group that are required to achieve a given level of recalibration performance. The analysis was performed with 51 base pair Illumina reads on pilot data from the 1000 Genomes Project. Downsampling can be achieved by specifying a genome interval using the -L option. For users concerned only with recalibration accuracy please disregard this plot and continue to use all available data when generating the recalibration table.


Comments (26)


Recalibrate base quality scores in order to correct sequencing errors and other experimental artifacts.


  • TBD


  1. Analyze patterns of covariation in the sequence dataset
  2. Do a second pass to analyze covariation remaining after recalibration
  3. Generate before/after plots
  4. Apply the recalibration to your sequence data

1. Analyze patterns of covariation in the sequence dataset


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T BaseRecalibrator \ 
    -R reference.fa \ 
    -I realigned_reads.bam \ 
    -L 20 \ 
    -knownSites dbsnp.vcf \ 
    -knownSites gold_indels.vcf \ 
    -o recal_data.table 

Expected Result

This creates a GATKReport file called recal_data.grp containing several tables. These tables contain the covariation data that will be used in a later step to recalibrate the base qualities of your sequence data.

It is imperative that you provide the program with a set of known sites, otherwise it will refuse to run. The known sites are used to build the covariation model and estimate empirical base qualities. For details on what to do if there are no known sites available for your organism of study, please see the online GATK documentation.

2. Do a second pass to analyze covariation remaining after recalibration


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T BaseRecalibrator \ 
    -R reference.fa \ 
    -I realigned_reads.bam \ 
    -L 20 \ 
    -knownSites dbsnp.vcf \ 
    -knownSites gold_indels.vcf \ 
    -BQSR recal_data.table \ 
    -o post_recal_data.table 

Expected Result

This creates another GATKReport file, which we will use in the next step to generate plots. Note the use of the -BQSR flag, which tells the GATK engine to perform on-the-fly recalibration based on the first recalibration data table.

3. Generate before/after plots


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T AnalyzeCovariates \ 
    -R reference.fa \ 
    -L 20 \ 
    -before recal_data.table \
    -after post_recal_data.table \
    -plots recalibration_plots.pdf

Expected Result

This generates a document called recalibration_plots.pdf containing plots that show how the reported base qualities match up to the empirical qualities calculated by the BaseRecalibrator. Comparing the before and after plots allows you to check the effect of the base recalibration process before you actually apply the recalibration to your sequence data. For details on how to interpret the base recalibration plots, please see the online GATK documentation.

4. Apply the recalibration to your sequence data


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T PrintReads \ 
    -R reference.fa \ 
    -I realigned_reads.bam \ 
    -L 20 \ 
    -BQSR recal_data.table \ 
    -o recal_reads.bam 

Expected Result

This creates a file called recal_reads.bam containing all the original reads, but now with exquisitely accurate base substitution, insertion and deletion quality scores. By default, the original quality scores are discarded in order to keep the file size down. However, you have the option to retain them by adding the flag –emit_original_quals to the PrintReads command, in which case the original qualities will also be written in the file, tagged OQ.

Notice how this step uses a very simple tool, PrintReads, to apply the recalibration. What’s happening here is that we are loading in the original sequence data, having the GATK engine recalibrate the base qualities on-the-fly thanks to the -BQSR flag (as explained earlier), and just using PrintReads to write out the resulting data to the new file.

Frequently Asked Questions

Comments (22)

1. Notes on known sites

Why are they important?

Each tool uses known sites differently, but what is common to all is that they use them to help distinguish true variants from false positives, which is very important to how these tools work. If you don't provide known sites, the statistical analysis of the data will be skewed, which can dramatically affect the sensitivity and reliability of the results.

In the variant calling pipeline, the only tools that do not strictly require known sites are UnifiedGenotyper and HaplotypeCaller.

Human genomes

If you're working on human genomes, you're in luck. We provide sets of known sites in the human genome as part of our resource bundle, and we can give you specific Best Practices recommendations on which sets to use for each tool in the variant calling pipeline. See the next section for details.

Non-human genomes

If you're working on genomes of other organisms, things may be a little harder -- but don't panic, we'll try to help as much as we can. We've started a community discussion in the forum on What are the standard resources for non-human genomes? in which we hope people with non-human genomics experience will share their knowledge.

And if it turns out that there is as yet no suitable set of known sites for your organisms, here's how to make your own for the purposes of BaseRecalibration: First, do an initial round of SNP calling on your original, unrecalibrated data. Then take the SNPs that you have the highest confidence in and use that set as the database of known SNPs by feeding it as a VCF file to the base quality score recalibrator. Finally, do a real round of SNP calling with the recalibrated data. These steps could be repeated several times until convergence. Good luck!

Some experimentation will be required to figure out the best way to find the highest confidence SNPs for use here. Perhaps one could call variants with several different calling algorithms and take the set intersection. Or perhaps one could do a very strict round of filtering and take only those variants which pass the test.

2. Recommended sets of known sites per tool

Summary table

Tool dbSNP 129 - - dbSNP >132 - - Mills indels - - 1KG indels - - HapMap - - Omni
RealignerTargetCreator X X
IndelRealigner X X
BaseRecalibrator X X X
(UnifiedGenotyper/ HaplotypeCaller) X
VariantRecalibrator X X X X
VariantEval X

RealignerTargetCreator and IndelRealigner

These tools require known indels passed with the -known argument to function properly. We use both the following files:

  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)


This tool requires known SNPs and indels passed with the -knownSites argument to function properly. We use all the following files:

  • The most recent dbSNP release (build ID > 132)
  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)

UnifiedGenotyper / HaplotypeCaller

These tools do NOT require known sites, but if SNPs are provided with the -dbsnp argument they will use them for variant annotation. We use this file:

  • The most recent dbSNP release (build ID > 132)


For VariantRecalibrator, please see the FAQ article on VQSR training sets and arguments.


This tool requires known SNPs passed with the -dbsnp argument to function properly. We use the following file:

  • A version of dbSNP subsetted to only sites discovered in or before dbSNP BuildID 129, which excludes the impact of the 1000 Genomes project and is useful for evaluation of dbSNP rate and Ti/Tv values at novel sites.
Comments (0)

A GATKReport is simply a text document that contains well-formatted, easy to read representation of some tabular data. Many GATK tools output their results as GATKReports, so it's important to understand how they are formatted and how you can use them in further analyses.

Here's a simple example:

#:GATKTable:ErrorRatePerCycle:The error rate per sequenced position in the reads
cycle  errorrate.61PA8.7         qualavg.61PA8.7                                         
0      7.451835696110506E-3      25.474613284804366                                      
1      2.362777171937477E-3      29.844949954504095                                      
2      9.087604507451836E-4      32.875909752547310
3      5.452562704471102E-4      34.498999090081895                                      
4      9.087604507451836E-4      35.148316651501370                                       
5      5.452562704471102E-4      36.072234352256190                                       
6      5.452562704471102E-4      36.121724890829700                                        
7      5.452562704471102E-4      36.191048034934500                                        
8      5.452562704471102E-4      36.003457059679770                                       

key    column
1:1000  T 
1:1001  A 
1:1002  C 

This report contains two individual GATK report tables. Every table begins with a header for its metadata and then a header for its name and description. The next row contains the column names followed by the data.

We provide an R library called gsalib that allows you to load GATKReport files into R for further analysis. Here are four simple steps to getting gsalib, installing it and loading a report.

1. Start R (or open RStudio)

$ R

R version 2.11.0 (2010-04-22)
Copyright (C) 2010 The R Foundation for Statistical Computing
ISBN 3-900051-07-0

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

  Natural language support but running in an English locale

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

2. Get the gsalib library from CRAN

The gsalib library is available on the Comprehensive R Archive Network, so you can just do:

> install.packages("gsalib") 

From within R (we use RStudio for convenience).

In some cases you need to explicitly tell R where to find the library; you can do this as follows:

$ cat .Rprofile 

3. Load the gsalib library

> library(gsalib)

4. Finally, load the GATKReport file and have fun

> d ="/path/to/my.gatkreport")
> summary(d)
              Length Class      Mode
CountVariants 27     data.frame list
CompOverlap   13     data.frame list

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Variant Discovery Overview

Once you've pre-processed your data according to our recommendations, you are ready to undertake the variant discovery process, i.e. identify the sites where your data displays variation relative to the reference genome, and calculate genotypes for each sample at that site. Unfortunately some of the variation you observe is caused by mapping and sequencing artifacts, so the greatest challenge here is to balance the need for sensitivity (to minimize false negatives, i.e. failing to identify real variants) vs. specificity (to minimize false positives, i.e. failing to reject artifacts). We have found that it is very difficult to reconcile these objectives in a single step, so instead we decompose the variant discovery process into separate steps: variant calling (performed per-sample), joint genotyping (performed per-cohort) and variant filtering (also performed per-cohort). The first two steps are designed to maximize sensitivity, while the filtering step aims to deliver a level of specificity that can be customized for each project.

Notes on which tools to use

  • The GATK includes two variant calling tools, HaplotypeCaller and UnifiedGenotyper. The HaplotypeCaller is a more recent and sophisticated tool than the UnifiedGenotyper, and we recommend using HaplotypeCaller in all cases, with only a few exceptions (see FAQs below).
  • For best results, the variant filtering should be done with the Variant Quality Score Recalibration (VQSR) tools. In some cases (small datasets, non-human organisms) this is not possible and must be done by applying hard filters instead (see FAQs below).


Comments (46)

This document describes the new approach to joint variant discovery that is available in GATK versions 3.0 and above.

Overview and motivations

This is meant to replace the joint discovery workflow that we previously recommended, which involved calling variants jointly on multiple samples, with a much smarter approach that reduces computational burden and solves the "N+1 problem".

This is the workflow recommended in our Best Practices for performing variant discovery analysis on cohorts of samples.

In a nutshell, we now call variants individually on each sample using the HaplotypeCaller in -ERC GVCF mode, leveraging the previously introduced reference model to produce a comprehensive record of genotype likelihoods and annotations for each site in the genome (or exome), in the form of a gVCF file (genomic VCF).

In a second step, we then perform a joint genotyping analysis of the gVCFs produced for all samples in a cohort.

This allows us to achieve the same results as joint calling in terms of accurate genotyping results, without the computational nightmare of exponential runtimes, and with the added flexibility of being able to re-run the population-level genotyping analysis at any time as the available cohort grows.

Workflow details

1. Variant calling

Run the HaplotypeCaller on each sample's BAM file(s) (if a sample's data is spread over more than one BAM, then pass them all in together) to create single-sample gVCFs, with the following options:

--emitRefConfidence GVCF --variant_index_type LINEAR --variant_index_parameter 128000

2. Optional data aggregation step

If you have more than a few hundred samples, run CombineGVCFs on batches of ~200 gVCFs to hierarchically merge them into a single gVCF. This will make the next step more tractable.

3. Joint genotyping

Take the outputs from step 2 (or step 1 if dealing with fewer samples) and run GenotypeGVCFs on all of them together to create the raw SNP and indel VCFs that are usually emitted by the callers.

4. Variant recalibration

Finally, resume the classic GATK Best Practices workflow by running VQSR on these "regular" VCFs according to our usual recommendations.

That's it! Fairly simple in practice, but we predict this is going to have a huge impact in how people perform variant discovery in large cohorts. We certainly hope it helps people deal with the challenges posed by ever-growing datasets.

As always, we look forward to comments and observations from the research community!

Comments (0)

This is a placeholder for a document that is under development. For now, please see the document that explains what is a gVCF. That document contains a brief explanation of what is the output of the reference confidence model.

Frequently Asked Questions

Comments (7)

The HaplotypeCaller is a more recent and sophisticated tool than the UnifiedGenotyper. Its ability to call SNPs is equivalent to that of the UnifiedGenotyper, and its ability to call indels is far superior. We recommend using HaplotypeCaller in all cases, with only a few exceptions:

  • If you want to analyze more than 100 samples at a time (for performance reasons)
  • If you are working with non-diploid organisms (UG can handle different levels of ploidy while HC cannot)
  • If you are working with pooled samples (also due to the HC’s limitation regarding ploidy)

In those cases, we recommend using UnifiedGenotyper instead of HaplotypeCaller.

Comments (77)

This document describes "regular" (variants-only) VCF files. For information on the gVCF format produced by HaplotypeCaller in -ERC GVCF mode, please see this companion document.

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence indicated by GQ = 25.92 isn't so good, largely because there were only a total of 4 reads at this site (DP =4), 1 of which was REF (=had the reference base) and 3 of which were ALT (=had the alternate base) (indicated by AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value that corresponds to a likelihood of 1.0). There's a chance that the subject is "hom-var" (=homozygous with the variant allele) since PL(1/1) = 26, which corresponds to 10^(-2.6), or 0.0025, but either way, it's clear that the subject is definitely not "hom-ref" (=homozygous with the reference allele) since PL(0/0) = 103, which corresponds to 10^(-10.3), a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).
Comments (0)


GVCF stands for Genomic VCF. A GVCF is a kind of VCF, so the basic format specification is the same as for a regular VCF (see the spec documentation here), but a Genomic VCF contains extra information.

This document explains what that extra information is and how you can use it to empower your variants analyses.

Important caveat

What we're covering here is strictly limited to GVCFs produced by HaplotypeCaller in GATK versions 3.0 and above. The term GVCF is sometimes used simply to describe VCFs that contain a record for every position in the genome (or interval of interest) regardless of whether a variant was detected at that site or not (such as VCFs produced by UnifiedGenotyper with --output_mode EMIT_ALL_SITES). GVCFs produced by HaplotypeCaller 3.x contain additional information that is formatted in a very specific way. Read on to find out more.

General comparison of VCF vs. gVCF

The key difference between a regular VCF and a gVCF is that the gVCF has records for all sites, whether there is a variant call there or not. The goal is to have every site represented in the file in order to do joint analysis of a cohort in subsequent steps. The records in a gVCF include an accurate estimation of how confident we are in the determination that the sites are homozygous-reference or not. This estimation is generated by the HaplotypeCaller's built-in reference model.

Note that some other tools (including the GATK's own UnifiedGenotyper) may output an all-sites VCF that looks superficially like the BP_RESOLUTION gVCFs produced by HaplotypeCaller, but they do not provide an accurate estimate of reference confidence, and therefore cannot be used in joint genotyping analyses.

The two types of gVCFs

As you can see in the figure above, there are two options you can use with -ERC: GVCF and BP_RESOLUTION. With BP_RESOLUTION, you get a gVCF with an individual record at every site: either a variant record, or a non-variant record. With GVCF, you get a gVCF with individual variant records for variant sites, but the non-variant sites are grouped together into non-variant block records that represent intervals of sites for which the genotype quality (GQ) is within a certain range or band. The GQ ranges are defined in the ##GVCFBlock line of the gVCF header. The purpose of the blocks (also called banding) is to keep file size down, and there is no downside for the downstream analysis, so we do recommend using the -GVCF option.

Example gVCF file

This is a banded gVCF produced by HaplotypeCaller with the -GVCF option.


As you can see in the first line, the basic file format is a valid version 4.1 VCF. See also the ##GVCFBlock lines (after the ##FORMAT lines) which indicate the GQ ranges used for banding, and the definition of the MIN_DP annotation in the ##FORMAT lines.

##ALT=<ID=NON_REF,Description="Represents any possible alternative allele at this location">
##FILTER=<ID=LowQual,Description="Low quality">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum DP observed within the GVCF block">
##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
##FORMAT=<ID=SB,Number=4,Type=Integer,Description="Per-sample component statistics which comprise the Fisher's Exact Test to detect strand bias.">
##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
##INFO=<ID=ClippingRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref number of hard clipped bases">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=END,Number=1,Type=Integer,Description="Stop position of the interval">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
##INFO=<ID=MLEAC,Number=A,Type=Integer,Description="Maximum likelihood expectation (MLE) for the allele counts (not necessarily the same as the AC), for each ALT allele, in the same order as listed">
##INFO=<ID=MLEAF,Number=A,Type=Float,Description="Maximum likelihood expectation (MLE) for the allele frequency (not necessarily the same as the AF), for each ALT allele, in the same order as listed">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">


The first thing you'll notice, hopefully, is the <NON_REF> symbolic allele listed in every record's ALT field. This provides us with a way to represent the possibility of having a non-reference allele at this site, and to indicate our confidence either way.

The second thing to look for is the END tag in the INFO field of non-variant block records. This tells you at what position the block ends. For example, the first line is a non-variant block that starts at position 20:10000000 and ends at 20:10000116.

20  10000000    .   T   <NON_REF>   .   .   END=10000116    GT:DP:GQ:MIN_DP:PL  0/0:44:99:38:0,89,1385
20  10000117    .   C   T,<NON_REF> 612.77  .   BaseQRankSum=0.000;ClippingRankSum=-0.411;DP=38;MLEAC=1,0;MLEAF=0.500,0.00;MQ=221.39;MQ0=0;MQRankSum=-2.172;ReadPosRankSum=-0.235   GT:AD:DP:GQ:PL:SB   0/1:17,21,0:38:99:641,0,456,691,519,1210:6,11,11,10
20  10000118    .   T   <NON_REF>   .   .   END=10000210    GT:DP:GQ:MIN_DP:PL  0/0:42:99:38:0,80,1314
20  10000211    .   C   T,<NON_REF> 638.77  .   BaseQRankSum=0.894;ClippingRankSum=-1.927;DP=42;MLEAC=1,0;MLEAF=0.500,0.00;MQ=221.89;MQ0=0;MQRankSum=-1.750;ReadPosRankSum=1.549    GT:AD:DP:GQ:PL:SB   0/1:20,22,0:42:99:667,0,566,728,632,1360:9,11,12,10
20  10000212    .   A   <NON_REF>   .   .   END=10000438    GT:DP:GQ:MIN_DP:PL  0/0:52:99:42:0,99,1403
20  10000439    .   T   G,<NON_REF> 1737.77 .   DP=57;MLEAC=2,0;MLEAF=1.00,0.00;MQ=221.41;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,56,0:56:99:1771,168,0,1771,168,1771:0,0,0,0
20  10000440    .   T   <NON_REF>   .   .   END=10000597    GT:DP:GQ:MIN_DP:PL  0/0:56:99:49:0,120,1800
20  10000598    .   T   A,<NON_REF> 1754.77 .   DP=54;MLEAC=2,0;MLEAF=1.00,0.00;MQ=185.55;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,53,0:53:99:1788,158,0,1788,158,1788:0,0,0,0
20  10000599    .   T   <NON_REF>   .   .   END=10000693    GT:DP:GQ:MIN_DP:PL  0/0:51:99:47:0,120,1800
20  10000694    .   G   A,<NON_REF> 961.77  .   BaseQRankSum=0.736;ClippingRankSum=-0.009;DP=54;MLEAC=1,0;MLEAF=0.500,0.00;MQ=106.92;MQ0=0;MQRankSum=0.482;ReadPosRankSum=1.537 GT:AD:DP:GQ:PL:SB   0/1:21,32,0:53:99:990,0,579,1053,675,1728:9,12,10,22
20  10000695    .   G   <NON_REF>   .   .   END=10000757    GT:DP:GQ:MIN_DP:PL  0/0:48:99:45:0,120,1800
20  10000758    .   T   A,<NON_REF> 1663.77 .   DP=51;MLEAC=2,0;MLEAF=1.00,0.00;MQ=59.32;MQ0=0  GT:AD:DP:GQ:PL:SB   1/1:0,50,0:50:99:1697,149,0,1697,149,1697:0,0,0,0
20  10000759    .   A   <NON_REF>   .   .   END=10001018    GT:DP:GQ:MIN_DP:PL  0/0:40:99:28:0,65,1080
20  10001019    .   T   G,<NON_REF> 93.77   .   BaseQRankSum=0.058;ClippingRankSum=-0.347;DP=26;MLEAC=1,0;MLEAF=0.500,0.00;MQ=29.65;MQ0=0;MQRankSum=-0.925;ReadPosRankSum=0.000 GT:AD:DP:GQ:PL:SB   0/1:19,7,0:26:99:122,0,494,179,515,694:12,7,4,3
20  10001020    .   C   <NON_REF>   .   .   END=10001020    GT:DP:GQ:MIN_DP:PL  0/0:26:72:26:0,72,1080
20  10001021    .   T   <NON_REF>   .   .   END=10001021    GT:DP:GQ:MIN_DP:PL  0/0:25:37:25:0,37,909
20  10001022    .   C   <NON_REF>   .   .   END=10001297    GT:DP:GQ:MIN_DP:PL  0/0:30:87:25:0,72,831
20  10001298    .   T   A,<NON_REF> 1404.77 .   DP=41;MLEAC=2,0;MLEAF=1.00,0.00;MQ=171.56;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,41,0:41:99:1438,123,0,1438,123,1438:0,0,0,0
20  10001299    .   C   <NON_REF>   .   .   END=10001386    GT:DP:GQ:MIN_DP:PL  0/0:43:99:39:0,95,1226
20  10001387    .   C   <NON_REF>   .   .   END=10001418    GT:DP:GQ:MIN_DP:PL  0/0:41:42:39:0,21,315
20  10001419    .   T   <NON_REF>   .   .   END=10001425    GT:DP:GQ:MIN_DP:PL  0/0:45:12:42:0,9,135
20  10001426    .   A   <NON_REF>   .   .   END=10001427    GT:DP:GQ:MIN_DP:PL  0/0:49:0:48:0,0,1282
20  10001428    .   T   <NON_REF>   .   .   END=10001428    GT:DP:GQ:MIN_DP:PL  0/0:49:21:49:0,21,315
20  10001429    .   G   <NON_REF>   .   .   END=10001429    GT:DP:GQ:MIN_DP:PL  0/0:47:18:47:0,18,270
20  10001430    .   G   <NON_REF>   .   .   END=10001431    GT:DP:GQ:MIN_DP:PL  0/0:45:0:44:0,0,1121
20  10001432    .   A   <NON_REF>   .   .   END=10001432    GT:DP:GQ:MIN_DP:PL  0/0:43:18:43:0,18,270
20  10001433    .   T   <NON_REF>   .   .   END=10001433    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,1201
20  10001434    .   G   <NON_REF>   .   .   END=10001434    GT:DP:GQ:MIN_DP:PL  0/0:44:18:44:0,18,270
20  10001435    .   A   <NON_REF>   .   .   END=10001435    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,1130
20  10001436    .   A   AAGGCT,<NON_REF>    1845.73 .   DP=43;MLEAC=2,0;MLEAF=1.00,0.00;MQ=220.07;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,42,0:42:99:1886,125,0,1888,126,1890:0,0,0,0
20  10001437    .   A   <NON_REF>   .   .   END=10001437    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,0

Note that toward the end of this snippet, you see multiple consecutive non-variant block records. These were not merged into a single record because the sites they contain belong to different ranges of GQ (which are defined in the header).

Comments (10)

Just because something looks like a SNP in IGV doesn't mean that it is of high quality. We are extremely confident in the genotype likelihoods calculations in the Unified Genotyper (especially for SNPs) and in the HaplotypeCaller (for all variants including indels). So, before you post this issue in our support forum, please do a little bit of investigation on your own, as follows.

To diagnose what is happening, you should take a look at the pileup of bases at the position in question. It is very important for you to look at the underlying data here.

Here is a checklist of questions you should ask yourself:

  • How many overlapping deletions are there at the position?

The genotyper ignores sites if there are too many overlapping deletions. This value can be set using the --max_deletion_fraction argument (see the UG's documentation page to find out what is the default value for this argument), but be aware that increasing it could affect the reliability of your results.

  • What do the base qualities look like for the non-reference bases?

Remember that there is a minimum base quality threshold and that low base qualities mean that the sequencer assigned a low confidence to that base. If your would-be SNP is only supported by low-confidence bases, it is probably a false positive.

Keep in mind that the depth reported in the VCF is the unfiltered depth. You may think you have good coverage at that site, but the Unified Genotyper ignores bases if they don't look good, so actual coverage seen by the UG may be lower than you think.

  • What do the mapping qualities look like for the reads with the non-reference bases?

A base's quality is capped by the mapping quality of its read. The reason for this is that low mapping qualities mean that the aligner had little confidence that the read is mapped to the correct location in the genome. You may be seeing mismatches because the read doesn't belong there -- you may be looking at the sequence of some other locus in the genome!

Keep in mind also that reads with mapping quality 255 ("unknown") are ignored.

  • Are there a lot of alternate alleles?

By default the UG will only consider a certain number of alternate alleles. This value can be set using the --max_alternate_alleles argument (see the UG's documentation page to find out what is the default value for this argument). Note however that genotyping sites with many alternate alleles is both CPU and memory intensive and it scales exponentially based on the number of alternate alleles. Unless there is a good reason to change the default value, we highly recommend that you not play around with this parameter.

  • Are you working with SOLiD data?

SOLiD alignments tend to have reference bias and it can be severe in some cases. Do the SOLiD reads have a lot of mismatches (no-calls count as mismatches) around the the site? If so, you are probably seeing false positives.

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Calling Variants with HaplotypeCaller in gVCF mode

Many variant callers specialize in either SNPs or Indels, or (like the GATK's own UnifiedGenotyper) have to call them using separate models of variation. The HaplotypeCaller is capable of calling SNPs and indels simultaneously via local de-novo assembly of haplotypes in an active region. In other words, whenever the program encounters a region showing signs of variation, it discards the existing mapping information and completely reassembles the reads in that region. This allows the HaplotypeCaller to be more accurate when calling regions that are traditionally difficult to call, for example when they contain different types of variants close to each other. It also makes the HaplotypeCaller much better at calling indels.

In addition, the HaplotypeCaller is able to estimate the probability that a given site is non-variant. This is very useful when you want to distinguish between cases where no variant was called because the evidence suggests that the site is non-variant, as opposed to cases where no call could be made either way because there was no data available. This capability, conferred by the reference confidence model, is used in the Best Practices workflow to produce a gVCF (short for genomic VCF) for each sample in a cohort.


Comments (46)

This document describes the new approach to joint variant discovery that is available in GATK versions 3.0 and above.

Overview and motivations

This is meant to replace the joint discovery workflow that we previously recommended, which involved calling variants jointly on multiple samples, with a much smarter approach that reduces computational burden and solves the "N+1 problem".

This is the workflow recommended in our Best Practices for performing variant discovery analysis on cohorts of samples.

In a nutshell, we now call variants individually on each sample using the HaplotypeCaller in -ERC GVCF mode, leveraging the previously introduced reference model to produce a comprehensive record of genotype likelihoods and annotations for each site in the genome (or exome), in the form of a gVCF file (genomic VCF).

In a second step, we then perform a joint genotyping analysis of the gVCFs produced for all samples in a cohort.

This allows us to achieve the same results as joint calling in terms of accurate genotyping results, without the computational nightmare of exponential runtimes, and with the added flexibility of being able to re-run the population-level genotyping analysis at any time as the available cohort grows.

Workflow details

1. Variant calling

Run the HaplotypeCaller on each sample's BAM file(s) (if a sample's data is spread over more than one BAM, then pass them all in together) to create single-sample gVCFs, with the following options:

--emitRefConfidence GVCF --variant_index_type LINEAR --variant_index_parameter 128000

2. Optional data aggregation step

If you have more than a few hundred samples, run CombineGVCFs on batches of ~200 gVCFs to hierarchically merge them into a single gVCF. This will make the next step more tractable.

3. Joint genotyping

Take the outputs from step 2 (or step 1 if dealing with fewer samples) and run GenotypeGVCFs on all of them together to create the raw SNP and indel VCFs that are usually emitted by the callers.

4. Variant recalibration

Finally, resume the classic GATK Best Practices workflow by running VQSR on these "regular" VCFs according to our usual recommendations.

That's it! Fairly simple in practice, but we predict this is going to have a huge impact in how people perform variant discovery in large cohorts. We certainly hope it helps people deal with the challenges posed by ever-growing datasets.

As always, we look forward to comments and observations from the research community!


Comments (35)


Call variants on a diploid genome with the HaplotypeCaller, producing a raw (unfiltered) VCF.


This is meant only for single-sample analysis. To analyze multiple samples, see the Best Practices documentation on joint analysis.


  • TBD


  1. Determine the basic parameters of the analysis
  2. Call variants in your sequence data

1. Determine the basic parameters of the analysis

If you do not specify these parameters yourself, the program will use default values. However we recommend that you set them explicitly because it will help you understand how the results are bounded and how you can modify the program's behavior.

  • Genotyping mode (–genotyping_mode)

This specifies how we want the program to determine the alternate alleles to use for genotyping. In the default DISCOVERY mode, the program will choose the most likely alleles out of those it sees in the data. In GENOTYPE_GIVEN_ALLELES mode, the program will only use the alleles passed in from a VCF file (using the -alleles argument). This is useful if you just want to determine if a sample has a specific genotype of interest and you are not interested in other alleles.

  • Emission confidence threshold (–stand_emit_conf)

This is the minimum confidence threshold (phred-scaled) at which the program should emit sites that appear to be possibly variant.

  • Calling confidence threshold (–stand_call_conf)

This is the minimum confidence threshold (phred-scaled) at which the program should emit variant sites as called. If a site's associated genotype has a confidence score lower than the calling threshold, the program will emit the site as filtered and will annotate it as LowQual. This threshold separates high confidence calls from low confidence calls.

The terms called and filtered are tricky because they can mean different things depending on context. In ordinary language, people often say a site was called if it was emitted as variant. But in the GATK's technical language, saying a site was called means that that site passed the confidence threshold test. For filtered, it's even more confusing, because in ordinary language, when people say that sites were filtered, they usually mean that those sites successfully passed a filtering test. However, in the GATK's technical language, the same phrase (saying that sites were filtered) means that those sites failed the filtering test. In effect, it means that those would be filtered out if the filter was used to actually remove low-confidence calls from the callset, instead of just tagging them. In both cases, both usages are valid depending on the point of view of the person who is reporting the results. So it's always important to check what is the context when interpreting results that include these terms.

2. Call variants in your sequence data


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T HaplotypeCaller \ 
    -R reference.fa \ 
    -I preprocessed_reads.bam \  # can be reduced or not
    -L 20 \ 
    --genotyping_mode DISCOVERY \ 
    -stand_emit_conf 10 \ 
    -stand_call_conf 30 \ 
    -o raw_variants.vcf 

Expected Result

This creates a VCF file called raw_variants.vcf, containing all the sites that the HaplotypeCaller evaluated to be potentially variant. Note that this file contains both SNPs and Indels.

Although you now have a nice fresh set of variant calls, the variant discovery stage is not over. The distinctions made by the caller itself between low-confidence calls and the rest is very primitive, and should not be taken as a definitive guide for filtering. The GATK callers are designed to be very lenient in calling variants, so it is extremely important to apply one of the recommended filtering methods (variant recalibration or hard-filtering), in order to move on to downstream analyses with the highest-quality call set possible.

Frequently Asked Questions

Comments (0)

As featured in this forum question.

Two main things account for these kinds of differences, both linked to default behaviors of the tools:

  • The tools downsample to different depths of coverage

  • The tools apply different read filters

In both cases, you can end up looking at different sets or numbers of reads, which causes some of the annotation values to be different. It's usually not a cause for alarm. Remember that many of these annotations should be interpreted relatively, not absolutely.

Comments (22)

1. Notes on known sites

Why are they important?

Each tool uses known sites differently, but what is common to all is that they use them to help distinguish true variants from false positives, which is very important to how these tools work. If you don't provide known sites, the statistical analysis of the data will be skewed, which can dramatically affect the sensitivity and reliability of the results.

In the variant calling pipeline, the only tools that do not strictly require known sites are UnifiedGenotyper and HaplotypeCaller.

Human genomes

If you're working on human genomes, you're in luck. We provide sets of known sites in the human genome as part of our resource bundle, and we can give you specific Best Practices recommendations on which sets to use for each tool in the variant calling pipeline. See the next section for details.

Non-human genomes

If you're working on genomes of other organisms, things may be a little harder -- but don't panic, we'll try to help as much as we can. We've started a community discussion in the forum on What are the standard resources for non-human genomes? in which we hope people with non-human genomics experience will share their knowledge.

And if it turns out that there is as yet no suitable set of known sites for your organisms, here's how to make your own for the purposes of BaseRecalibration: First, do an initial round of SNP calling on your original, unrecalibrated data. Then take the SNPs that you have the highest confidence in and use that set as the database of known SNPs by feeding it as a VCF file to the base quality score recalibrator. Finally, do a real round of SNP calling with the recalibrated data. These steps could be repeated several times until convergence. Good luck!

Some experimentation will be required to figure out the best way to find the highest confidence SNPs for use here. Perhaps one could call variants with several different calling algorithms and take the set intersection. Or perhaps one could do a very strict round of filtering and take only those variants which pass the test.

2. Recommended sets of known sites per tool

Summary table

Tool dbSNP 129 - - dbSNP >132 - - Mills indels - - 1KG indels - - HapMap - - Omni
RealignerTargetCreator X X
IndelRealigner X X
BaseRecalibrator X X X
(UnifiedGenotyper/ HaplotypeCaller) X
VariantRecalibrator X X X X
VariantEval X

RealignerTargetCreator and IndelRealigner

These tools require known indels passed with the -known argument to function properly. We use both the following files:

  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)


This tool requires known SNPs and indels passed with the -knownSites argument to function properly. We use all the following files:

  • The most recent dbSNP release (build ID > 132)
  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)

UnifiedGenotyper / HaplotypeCaller

These tools do NOT require known sites, but if SNPs are provided with the -dbsnp argument they will use them for variant annotation. We use this file:

  • The most recent dbSNP release (build ID > 132)


For VariantRecalibrator, please see the FAQ article on VQSR training sets and arguments.


This tool requires known SNPs passed with the -dbsnp argument to function properly. We use the following file:

  • A version of dbSNP subsetted to only sites discovered in or before dbSNP BuildID 129, which excludes the impact of the 1000 Genomes project and is useful for evaluation of dbSNP rate and Ti/Tv values at novel sites.
Comments (10)

Just because something looks like a SNP in IGV doesn't mean that it is of high quality. We are extremely confident in the genotype likelihoods calculations in the Unified Genotyper (especially for SNPs) and in the HaplotypeCaller (for all variants including indels). So, before you post this issue in our support forum, please do a little bit of investigation on your own, as follows.

To diagnose what is happening, you should take a look at the pileup of bases at the position in question. It is very important for you to look at the underlying data here.

Here is a checklist of questions you should ask yourself:

  • How many overlapping deletions are there at the position?

The genotyper ignores sites if there are too many overlapping deletions. This value can be set using the --max_deletion_fraction argument (see the UG's documentation page to find out what is the default value for this argument), but be aware that increasing it could affect the reliability of your results.

  • What do the base qualities look like for the non-reference bases?

Remember that there is a minimum base quality threshold and that low base qualities mean that the sequencer assigned a low confidence to that base. If your would-be SNP is only supported by low-confidence bases, it is probably a false positive.

Keep in mind that the depth reported in the VCF is the unfiltered depth. You may think you have good coverage at that site, but the Unified Genotyper ignores bases if they don't look good, so actual coverage seen by the UG may be lower than you think.

  • What do the mapping qualities look like for the reads with the non-reference bases?

A base's quality is capped by the mapping quality of its read. The reason for this is that low mapping qualities mean that the aligner had little confidence that the read is mapped to the correct location in the genome. You may be seeing mismatches because the read doesn't belong there -- you may be looking at the sequence of some other locus in the genome!

Keep in mind also that reads with mapping quality 255 ("unknown") are ignored.

  • Are there a lot of alternate alleles?

By default the UG will only consider a certain number of alternate alleles. This value can be set using the --max_alternate_alleles argument (see the UG's documentation page to find out what is the default value for this argument). Note however that genotyping sites with many alternate alleles is both CPU and memory intensive and it scales exponentially based on the number of alternate alleles. Unless there is a good reason to change the default value, we highly recommend that you not play around with this parameter.

  • Are you working with SOLiD data?

SOLiD alignments tend to have reference bias and it can be severe in some cases. Do the SOLiD reads have a lot of mismatches (no-calls count as mismatches) around the the site? If so, you are probably seeing false positives.

Comments (0)


GVCF stands for Genomic VCF. A GVCF is a kind of VCF, so the basic format specification is the same as for a regular VCF (see the spec documentation here), but a Genomic VCF contains extra information.

This document explains what that extra information is and how you can use it to empower your variants analyses.

Important caveat

What we're covering here is strictly limited to GVCFs produced by HaplotypeCaller in GATK versions 3.0 and above. The term GVCF is sometimes used simply to describe VCFs that contain a record for every position in the genome (or interval of interest) regardless of whether a variant was detected at that site or not (such as VCFs produced by UnifiedGenotyper with --output_mode EMIT_ALL_SITES). GVCFs produced by HaplotypeCaller 3.x contain additional information that is formatted in a very specific way. Read on to find out more.

General comparison of VCF vs. gVCF

The key difference between a regular VCF and a gVCF is that the gVCF has records for all sites, whether there is a variant call there or not. The goal is to have every site represented in the file in order to do joint analysis of a cohort in subsequent steps. The records in a gVCF include an accurate estimation of how confident we are in the determination that the sites are homozygous-reference or not. This estimation is generated by the HaplotypeCaller's built-in reference model.

Note that some other tools (including the GATK's own UnifiedGenotyper) may output an all-sites VCF that looks superficially like the BP_RESOLUTION gVCFs produced by HaplotypeCaller, but they do not provide an accurate estimate of reference confidence, and therefore cannot be used in joint genotyping analyses.

The two types of gVCFs

As you can see in the figure above, there are two options you can use with -ERC: GVCF and BP_RESOLUTION. With BP_RESOLUTION, you get a gVCF with an individual record at every site: either a variant record, or a non-variant record. With GVCF, you get a gVCF with individual variant records for variant sites, but the non-variant sites are grouped together into non-variant block records that represent intervals of sites for which the genotype quality (GQ) is within a certain range or band. The GQ ranges are defined in the ##GVCFBlock line of the gVCF header. The purpose of the blocks (also called banding) is to keep file size down, and there is no downside for the downstream analysis, so we do recommend using the -GVCF option.

Example gVCF file

This is a banded gVCF produced by HaplotypeCaller with the -GVCF option.


As you can see in the first line, the basic file format is a valid version 4.1 VCF. See also the ##GVCFBlock lines (after the ##FORMAT lines) which indicate the GQ ranges used for banding, and the definition of the MIN_DP annotation in the ##FORMAT lines.

##ALT=<ID=NON_REF,Description="Represents any possible alternative allele at this location">
##FILTER=<ID=LowQual,Description="Low quality">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum DP observed within the GVCF block">
##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
##FORMAT=<ID=SB,Number=4,Type=Integer,Description="Per-sample component statistics which comprise the Fisher's Exact Test to detect strand bias.">
##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
##INFO=<ID=ClippingRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref number of hard clipped bases">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=END,Number=1,Type=Integer,Description="Stop position of the interval">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
##INFO=<ID=MLEAC,Number=A,Type=Integer,Description="Maximum likelihood expectation (MLE) for the allele counts (not necessarily the same as the AC), for each ALT allele, in the same order as listed">
##INFO=<ID=MLEAF,Number=A,Type=Float,Description="Maximum likelihood expectation (MLE) for the allele frequency (not necessarily the same as the AF), for each ALT allele, in the same order as listed">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">


The first thing you'll notice, hopefully, is the <NON_REF> symbolic allele listed in every record's ALT field. This provides us with a way to represent the possibility of having a non-reference allele at this site, and to indicate our confidence either way.

The second thing to look for is the END tag in the INFO field of non-variant block records. This tells you at what position the block ends. For example, the first line is a non-variant block that starts at position 20:10000000 and ends at 20:10000116.

20  10000000    .   T   <NON_REF>   .   .   END=10000116    GT:DP:GQ:MIN_DP:PL  0/0:44:99:38:0,89,1385
20  10000117    .   C   T,<NON_REF> 612.77  .   BaseQRankSum=0.000;ClippingRankSum=-0.411;DP=38;MLEAC=1,0;MLEAF=0.500,0.00;MQ=221.39;MQ0=0;MQRankSum=-2.172;ReadPosRankSum=-0.235   GT:AD:DP:GQ:PL:SB   0/1:17,21,0:38:99:641,0,456,691,519,1210:6,11,11,10
20  10000118    .   T   <NON_REF>   .   .   END=10000210    GT:DP:GQ:MIN_DP:PL  0/0:42:99:38:0,80,1314
20  10000211    .   C   T,<NON_REF> 638.77  .   BaseQRankSum=0.894;ClippingRankSum=-1.927;DP=42;MLEAC=1,0;MLEAF=0.500,0.00;MQ=221.89;MQ0=0;MQRankSum=-1.750;ReadPosRankSum=1.549    GT:AD:DP:GQ:PL:SB   0/1:20,22,0:42:99:667,0,566,728,632,1360:9,11,12,10
20  10000212    .   A   <NON_REF>   .   .   END=10000438    GT:DP:GQ:MIN_DP:PL  0/0:52:99:42:0,99,1403
20  10000439    .   T   G,<NON_REF> 1737.77 .   DP=57;MLEAC=2,0;MLEAF=1.00,0.00;MQ=221.41;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,56,0:56:99:1771,168,0,1771,168,1771:0,0,0,0
20  10000440    .   T   <NON_REF>   .   .   END=10000597    GT:DP:GQ:MIN_DP:PL  0/0:56:99:49:0,120,1800
20  10000598    .   T   A,<NON_REF> 1754.77 .   DP=54;MLEAC=2,0;MLEAF=1.00,0.00;MQ=185.55;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,53,0:53:99:1788,158,0,1788,158,1788:0,0,0,0
20  10000599    .   T   <NON_REF>   .   .   END=10000693    GT:DP:GQ:MIN_DP:PL  0/0:51:99:47:0,120,1800
20  10000694    .   G   A,<NON_REF> 961.77  .   BaseQRankSum=0.736;ClippingRankSum=-0.009;DP=54;MLEAC=1,0;MLEAF=0.500,0.00;MQ=106.92;MQ0=0;MQRankSum=0.482;ReadPosRankSum=1.537 GT:AD:DP:GQ:PL:SB   0/1:21,32,0:53:99:990,0,579,1053,675,1728:9,12,10,22
20  10000695    .   G   <NON_REF>   .   .   END=10000757    GT:DP:GQ:MIN_DP:PL  0/0:48:99:45:0,120,1800
20  10000758    .   T   A,<NON_REF> 1663.77 .   DP=51;MLEAC=2,0;MLEAF=1.00,0.00;MQ=59.32;MQ0=0  GT:AD:DP:GQ:PL:SB   1/1:0,50,0:50:99:1697,149,0,1697,149,1697:0,0,0,0
20  10000759    .   A   <NON_REF>   .   .   END=10001018    GT:DP:GQ:MIN_DP:PL  0/0:40:99:28:0,65,1080
20  10001019    .   T   G,<NON_REF> 93.77   .   BaseQRankSum=0.058;ClippingRankSum=-0.347;DP=26;MLEAC=1,0;MLEAF=0.500,0.00;MQ=29.65;MQ0=0;MQRankSum=-0.925;ReadPosRankSum=0.000 GT:AD:DP:GQ:PL:SB   0/1:19,7,0:26:99:122,0,494,179,515,694:12,7,4,3
20  10001020    .   C   <NON_REF>   .   .   END=10001020    GT:DP:GQ:MIN_DP:PL  0/0:26:72:26:0,72,1080
20  10001021    .   T   <NON_REF>   .   .   END=10001021    GT:DP:GQ:MIN_DP:PL  0/0:25:37:25:0,37,909
20  10001022    .   C   <NON_REF>   .   .   END=10001297    GT:DP:GQ:MIN_DP:PL  0/0:30:87:25:0,72,831
20  10001298    .   T   A,<NON_REF> 1404.77 .   DP=41;MLEAC=2,0;MLEAF=1.00,0.00;MQ=171.56;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,41,0:41:99:1438,123,0,1438,123,1438:0,0,0,0
20  10001299    .   C   <NON_REF>   .   .   END=10001386    GT:DP:GQ:MIN_DP:PL  0/0:43:99:39:0,95,1226
20  10001387    .   C   <NON_REF>   .   .   END=10001418    GT:DP:GQ:MIN_DP:PL  0/0:41:42:39:0,21,315
20  10001419    .   T   <NON_REF>   .   .   END=10001425    GT:DP:GQ:MIN_DP:PL  0/0:45:12:42:0,9,135
20  10001426    .   A   <NON_REF>   .   .   END=10001427    GT:DP:GQ:MIN_DP:PL  0/0:49:0:48:0,0,1282
20  10001428    .   T   <NON_REF>   .   .   END=10001428    GT:DP:GQ:MIN_DP:PL  0/0:49:21:49:0,21,315
20  10001429    .   G   <NON_REF>   .   .   END=10001429    GT:DP:GQ:MIN_DP:PL  0/0:47:18:47:0,18,270
20  10001430    .   G   <NON_REF>   .   .   END=10001431    GT:DP:GQ:MIN_DP:PL  0/0:45:0:44:0,0,1121
20  10001432    .   A   <NON_REF>   .   .   END=10001432    GT:DP:GQ:MIN_DP:PL  0/0:43:18:43:0,18,270
20  10001433    .   T   <NON_REF>   .   .   END=10001433    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,1201
20  10001434    .   G   <NON_REF>   .   .   END=10001434    GT:DP:GQ:MIN_DP:PL  0/0:44:18:44:0,18,270
20  10001435    .   A   <NON_REF>   .   .   END=10001435    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,1130
20  10001436    .   A   AAGGCT,<NON_REF>    1845.73 .   DP=43;MLEAC=2,0;MLEAF=1.00,0.00;MQ=220.07;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,42,0:42:99:1886,125,0,1888,126,1890:0,0,0,0
20  10001437    .   A   <NON_REF>   .   .   END=10001437    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,0

Note that toward the end of this snippet, you see multiple consecutive non-variant block records. These were not merged into a single record because the sites they contain belong to different ranges of GQ (which are defined in the header).

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Joint Genotyping of Multiple Sample gVCFs

This is a placeholder for a document in preparation.


Comments (46)

This document describes the new approach to joint variant discovery that is available in GATK versions 3.0 and above.

Overview and motivations

This is meant to replace the joint discovery workflow that we previously recommended, which involved calling variants jointly on multiple samples, with a much smarter approach that reduces computational burden and solves the "N+1 problem".

This is the workflow recommended in our Best Practices for performing variant discovery analysis on cohorts of samples.

In a nutshell, we now call variants individually on each sample using the HaplotypeCaller in -ERC GVCF mode, leveraging the previously introduced reference model to produce a comprehensive record of genotype likelihoods and annotations for each site in the genome (or exome), in the form of a gVCF file (genomic VCF).

In a second step, we then perform a joint genotyping analysis of the gVCFs produced for all samples in a cohort.

This allows us to achieve the same results as joint calling in terms of accurate genotyping results, without the computational nightmare of exponential runtimes, and with the added flexibility of being able to re-run the population-level genotyping analysis at any time as the available cohort grows.

Workflow details

1. Variant calling

Run the HaplotypeCaller on each sample's BAM file(s) (if a sample's data is spread over more than one BAM, then pass them all in together) to create single-sample gVCFs, with the following options:

--emitRefConfidence GVCF --variant_index_type LINEAR --variant_index_parameter 128000

2. Optional data aggregation step

If you have more than a few hundred samples, run CombineGVCFs on batches of ~200 gVCFs to hierarchically merge them into a single gVCF. This will make the next step more tractable.

3. Joint genotyping

Take the outputs from step 2 (or step 1 if dealing with fewer samples) and run GenotypeGVCFs on all of them together to create the raw SNP and indel VCFs that are usually emitted by the callers.

4. Variant recalibration

Finally, resume the classic GATK Best Practices workflow by running VQSR on these "regular" VCFs according to our usual recommendations.

That's it! Fairly simple in practice, but we predict this is going to have a huge impact in how people perform variant discovery in large cohorts. We certainly hope it helps people deal with the challenges posed by ever-growing datasets.

As always, we look forward to comments and observations from the research community!

Frequently Asked Questions

Comments (0)


GVCF stands for Genomic VCF. A GVCF is a kind of VCF, so the basic format specification is the same as for a regular VCF (see the spec documentation here), but a Genomic VCF contains extra information.

This document explains what that extra information is and how you can use it to empower your variants analyses.

Important caveat

What we're covering here is strictly limited to GVCFs produced by HaplotypeCaller in GATK versions 3.0 and above. The term GVCF is sometimes used simply to describe VCFs that contain a record for every position in the genome (or interval of interest) regardless of whether a variant was detected at that site or not (such as VCFs produced by UnifiedGenotyper with --output_mode EMIT_ALL_SITES). GVCFs produced by HaplotypeCaller 3.x contain additional information that is formatted in a very specific way. Read on to find out more.

General comparison of VCF vs. gVCF

The key difference between a regular VCF and a gVCF is that the gVCF has records for all sites, whether there is a variant call there or not. The goal is to have every site represented in the file in order to do joint analysis of a cohort in subsequent steps. The records in a gVCF include an accurate estimation of how confident we are in the determination that the sites are homozygous-reference or not. This estimation is generated by the HaplotypeCaller's built-in reference model.

Note that some other tools (including the GATK's own UnifiedGenotyper) may output an all-sites VCF that looks superficially like the BP_RESOLUTION gVCFs produced by HaplotypeCaller, but they do not provide an accurate estimate of reference confidence, and therefore cannot be used in joint genotyping analyses.

The two types of gVCFs

As you can see in the figure above, there are two options you can use with -ERC: GVCF and BP_RESOLUTION. With BP_RESOLUTION, you get a gVCF with an individual record at every site: either a variant record, or a non-variant record. With GVCF, you get a gVCF with individual variant records for variant sites, but the non-variant sites are grouped together into non-variant block records that represent intervals of sites for which the genotype quality (GQ) is within a certain range or band. The GQ ranges are defined in the ##GVCFBlock line of the gVCF header. The purpose of the blocks (also called banding) is to keep file size down, and there is no downside for the downstream analysis, so we do recommend using the -GVCF option.

Example gVCF file

This is a banded gVCF produced by HaplotypeCaller with the -GVCF option.


As you can see in the first line, the basic file format is a valid version 4.1 VCF. See also the ##GVCFBlock lines (after the ##FORMAT lines) which indicate the GQ ranges used for banding, and the definition of the MIN_DP annotation in the ##FORMAT lines.

##ALT=<ID=NON_REF,Description="Represents any possible alternative allele at this location">
##FILTER=<ID=LowQual,Description="Low quality">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum DP observed within the GVCF block">
##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
##FORMAT=<ID=SB,Number=4,Type=Integer,Description="Per-sample component statistics which comprise the Fisher's Exact Test to detect strand bias.">
##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
##INFO=<ID=ClippingRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref number of hard clipped bases">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=END,Number=1,Type=Integer,Description="Stop position of the interval">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
##INFO=<ID=MLEAC,Number=A,Type=Integer,Description="Maximum likelihood expectation (MLE) for the allele counts (not necessarily the same as the AC), for each ALT allele, in the same order as listed">
##INFO=<ID=MLEAF,Number=A,Type=Float,Description="Maximum likelihood expectation (MLE) for the allele frequency (not necessarily the same as the AF), for each ALT allele, in the same order as listed">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">


The first thing you'll notice, hopefully, is the <NON_REF> symbolic allele listed in every record's ALT field. This provides us with a way to represent the possibility of having a non-reference allele at this site, and to indicate our confidence either way.

The second thing to look for is the END tag in the INFO field of non-variant block records. This tells you at what position the block ends. For example, the first line is a non-variant block that starts at position 20:10000000 and ends at 20:10000116.

20  10000000    .   T   <NON_REF>   .   .   END=10000116    GT:DP:GQ:MIN_DP:PL  0/0:44:99:38:0,89,1385
20  10000117    .   C   T,<NON_REF> 612.77  .   BaseQRankSum=0.000;ClippingRankSum=-0.411;DP=38;MLEAC=1,0;MLEAF=0.500,0.00;MQ=221.39;MQ0=0;MQRankSum=-2.172;ReadPosRankSum=-0.235   GT:AD:DP:GQ:PL:SB   0/1:17,21,0:38:99:641,0,456,691,519,1210:6,11,11,10
20  10000118    .   T   <NON_REF>   .   .   END=10000210    GT:DP:GQ:MIN_DP:PL  0/0:42:99:38:0,80,1314
20  10000211    .   C   T,<NON_REF> 638.77  .   BaseQRankSum=0.894;ClippingRankSum=-1.927;DP=42;MLEAC=1,0;MLEAF=0.500,0.00;MQ=221.89;MQ0=0;MQRankSum=-1.750;ReadPosRankSum=1.549    GT:AD:DP:GQ:PL:SB   0/1:20,22,0:42:99:667,0,566,728,632,1360:9,11,12,10
20  10000212    .   A   <NON_REF>   .   .   END=10000438    GT:DP:GQ:MIN_DP:PL  0/0:52:99:42:0,99,1403
20  10000439    .   T   G,<NON_REF> 1737.77 .   DP=57;MLEAC=2,0;MLEAF=1.00,0.00;MQ=221.41;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,56,0:56:99:1771,168,0,1771,168,1771:0,0,0,0
20  10000440    .   T   <NON_REF>   .   .   END=10000597    GT:DP:GQ:MIN_DP:PL  0/0:56:99:49:0,120,1800
20  10000598    .   T   A,<NON_REF> 1754.77 .   DP=54;MLEAC=2,0;MLEAF=1.00,0.00;MQ=185.55;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,53,0:53:99:1788,158,0,1788,158,1788:0,0,0,0
20  10000599    .   T   <NON_REF>   .   .   END=10000693    GT:DP:GQ:MIN_DP:PL  0/0:51:99:47:0,120,1800
20  10000694    .   G   A,<NON_REF> 961.77  .   BaseQRankSum=0.736;ClippingRankSum=-0.009;DP=54;MLEAC=1,0;MLEAF=0.500,0.00;MQ=106.92;MQ0=0;MQRankSum=0.482;ReadPosRankSum=1.537 GT:AD:DP:GQ:PL:SB   0/1:21,32,0:53:99:990,0,579,1053,675,1728:9,12,10,22
20  10000695    .   G   <NON_REF>   .   .   END=10000757    GT:DP:GQ:MIN_DP:PL  0/0:48:99:45:0,120,1800
20  10000758    .   T   A,<NON_REF> 1663.77 .   DP=51;MLEAC=2,0;MLEAF=1.00,0.00;MQ=59.32;MQ0=0  GT:AD:DP:GQ:PL:SB   1/1:0,50,0:50:99:1697,149,0,1697,149,1697:0,0,0,0
20  10000759    .   A   <NON_REF>   .   .   END=10001018    GT:DP:GQ:MIN_DP:PL  0/0:40:99:28:0,65,1080
20  10001019    .   T   G,<NON_REF> 93.77   .   BaseQRankSum=0.058;ClippingRankSum=-0.347;DP=26;MLEAC=1,0;MLEAF=0.500,0.00;MQ=29.65;MQ0=0;MQRankSum=-0.925;ReadPosRankSum=0.000 GT:AD:DP:GQ:PL:SB   0/1:19,7,0:26:99:122,0,494,179,515,694:12,7,4,3
20  10001020    .   C   <NON_REF>   .   .   END=10001020    GT:DP:GQ:MIN_DP:PL  0/0:26:72:26:0,72,1080
20  10001021    .   T   <NON_REF>   .   .   END=10001021    GT:DP:GQ:MIN_DP:PL  0/0:25:37:25:0,37,909
20  10001022    .   C   <NON_REF>   .   .   END=10001297    GT:DP:GQ:MIN_DP:PL  0/0:30:87:25:0,72,831
20  10001298    .   T   A,<NON_REF> 1404.77 .   DP=41;MLEAC=2,0;MLEAF=1.00,0.00;MQ=171.56;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,41,0:41:99:1438,123,0,1438,123,1438:0,0,0,0
20  10001299    .   C   <NON_REF>   .   .   END=10001386    GT:DP:GQ:MIN_DP:PL  0/0:43:99:39:0,95,1226
20  10001387    .   C   <NON_REF>   .   .   END=10001418    GT:DP:GQ:MIN_DP:PL  0/0:41:42:39:0,21,315
20  10001419    .   T   <NON_REF>   .   .   END=10001425    GT:DP:GQ:MIN_DP:PL  0/0:45:12:42:0,9,135
20  10001426    .   A   <NON_REF>   .   .   END=10001427    GT:DP:GQ:MIN_DP:PL  0/0:49:0:48:0,0,1282
20  10001428    .   T   <NON_REF>   .   .   END=10001428    GT:DP:GQ:MIN_DP:PL  0/0:49:21:49:0,21,315
20  10001429    .   G   <NON_REF>   .   .   END=10001429    GT:DP:GQ:MIN_DP:PL  0/0:47:18:47:0,18,270
20  10001430    .   G   <NON_REF>   .   .   END=10001431    GT:DP:GQ:MIN_DP:PL  0/0:45:0:44:0,0,1121
20  10001432    .   A   <NON_REF>   .   .   END=10001432    GT:DP:GQ:MIN_DP:PL  0/0:43:18:43:0,18,270
20  10001433    .   T   <NON_REF>   .   .   END=10001433    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,1201
20  10001434    .   G   <NON_REF>   .   .   END=10001434    GT:DP:GQ:MIN_DP:PL  0/0:44:18:44:0,18,270
20  10001435    .   A   <NON_REF>   .   .   END=10001435    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,1130
20  10001436    .   A   AAGGCT,<NON_REF>    1845.73 .   DP=43;MLEAC=2,0;MLEAF=1.00,0.00;MQ=220.07;MQ0=0 GT:AD:DP:GQ:PL:SB   1/1:0,42,0:42:99:1886,125,0,1888,126,1890:0,0,0,0
20  10001437    .   A   <NON_REF>   .   .   END=10001437    GT:DP:GQ:MIN_DP:PL  0/0:44:0:44:0,0,0

Note that toward the end of this snippet, you see multiple consecutive non-variant block records. These were not merged into a single record because the sites they contain belong to different ranges of GQ (which are defined in the header).

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Variant Filtering with VQSR

The GATK callers (HaplotypeCaller and UnifiedGenotyper) are by design very lenient in calling variants in order to achieve a high degree of sensitivity. This is a good thing because it minimizes the chance of missing real variants, but it does mean that we need to refine the call set to reduce the amount of false positives, which can be quite large. The best way to perform this refinement is to use variant quality score recalibration (VQSR). In the first step of this two-step process, the program uses machine learning methods to assign a well-calibrated probability to each variant call in a raw call set. We can then use this variant quality score in the second step to filter the raw call set, thus producing a subset of calls with our desired level of quality, fine-tuned to balance specificity and sensitivity.

The downside of how variant recalibration works is that the algorithm requires high-quality sets of known variants to use as training and truth resources, which for many organisms are not yet available. It also requires quite a lot of data in order to learn the profiles of good vs. bad variants, so it can be difficult or even impossible to use on small datasets that involve only one or a few samples, or on targeted sequencing data. If for either of these reasons you find that you cannot perform variant recalibration on your data, we recommend you use hard-filtering instead. See the methods articles and FAQs for more details on how to do this.


Comments (128)

This document describes what Variant Quality Score Recalibration (VQSR) is designed to do, and outlines how it works under the hood. For command-line examples and recommendations on what specific resource datasets and arguments to use for VQSR, please see this FAQ article.

As a complement to this document, we encourage you to watch the workshop videos available on our Events webpage.

Slides that explain the VQSR methodology in more detail as well as the individual component variant annotations can be found here in the GSA Public Drop Box.

Detailed information about command line options for VariantRecalibrator can be found here.

Detailed information about command line options for ApplyRecalibration can be found here.


The purpose of variant recalibration is to assign a well-calibrated probability to each variant call in a call set. This enables you to generate highly accurate call sets by filtering based on this single estimate for the accuracy of each call.

The approach taken by variant quality score recalibration is to develop a continuous, covarying estimate of the relationship between SNP call annotations (QD, SB, HaplotypeScore, HRun, for example) and the the probability that a SNP is a true genetic variant versus a sequencing or data processing artifact. This model is determined adaptively based on "true sites" provided as input (typically HapMap 3 sites and those sites found to be polymorphic on the Omni 2.5M SNP chip array, for humans). This adaptive error model can then be applied to both known and novel variation discovered in the call set of interest to evaluate the probability that each call is real. The score that gets added to the INFO field of each variant is called the VQSLOD. It is the log odds ratio of being a true variant versus being false under the trained Gaussian mixture model.

The variant recalibrator contrastively evaluates variants in a two step process, each performed by a distinct tool:

  • VariantRecalibrator
    Create a Gaussian mixture model by looking at the annotations values over a high quality subset of the input call set and then evaluate all input variants. This step produces a recalibration file.

  • ApplyRecalibration
    Apply the model parameters to each variant in input VCF files producing a recalibrated VCF file in which each variant is annotated with its VQSLOD value. In addition, this step will filter the calls based on this new lod score by adding lines to the FILTER column for variants that don't meet the specified lod threshold.

Please see the VQSR tutorial for step-by-step instructions on running these tools.

How VariantRecalibrator works in a nutshell

The tool takes the overlap of the training/truth resource sets and of your callset. It models the distribution of these variants relative to the annotations you specified, and attempts to group them into clusters. Then it uses the clustering to assign VQSLOD scores to all variants. Variants that are closer to the heart of a cluster will get a higher score than variants that are outliers.

How ApplyRecalibration works in a nutshell

During the first part of the recalibration process, variants in your callset were given a score called VQSLOD. At the same time, variants in your training sets were also ranked by VQSLOD. When you specify a tranche sensitivity threshold with ApplyRecalibration, expressed as a percentage (e.g. 99.9%), what happens is that the program looks at what is the VQSLOD value above which 99.9% of the variants in the training callset are included. It then takes that value of VQSLOD and uses it as a threshold to filter your variants. Variants that are above the threshold pass the filter, so the FILTER field will contain PASS. Variants that are below the threshold will be filtered out; they will be written to the output file, but in the FILTER field they will have the name of the tranche they belonged to. So VQSRTrancheSNP99.90to100.00 means that the variant was in the range of VQSLODs corresponding to the remaining 0.1% of the training set, which are basically considered false positives.

Interpretation of the Gaussian mixture model plots

The variant recalibration step fits a Gaussian mixture model to the contextual annotations given to each variant. By fitting this probability model to the training variants (variants considered to be true-positives), a probability can be assigned to the putative novel variants (some of which will be true-positives, some of which will be false-positives). It is useful for users to see how the probability model was fit to their data. Therefore a modeling report is automatically generated each time VariantRecalibrator is run (in the above command line the report will appear as path/to/output.plots.R.pdf). For every pair-wise combination of annotations used in modeling, a 2D projection of the Gaussian mixture model is shown.

The figure shows one page of an example Gaussian mixture model report that is automatically generated by the VQSR from the example HiSeq call set. This page shows the 2D projection of mapping quality rank sum test versus Haplotype score by marginalizing over the other annotation dimensions in the model.

In each page there are four panels which show different ways of looking at the 2D projection of the model. The upper left panel shows the probability density function that was fit to the data. The 2D projection was created by marginalizing over the other annotation dimensions in the model via random sampling. Green areas show locations in the space that are indicative of being high quality while red areas show the lowest probability areas. In general putative SNPs that fall in the red regions will be filtered out of the recalibrated call set.

The remaining three panels give scatter plots in which each SNP is plotted in the two annotation dimensions as points in a point cloud. The scale for each dimension is in normalized units. The data for the three panels is the same but the points are colored in different ways to highlight different aspects of the data. In the upper right panel SNPs are colored black and red to show which SNPs are retained and filtered, respectively, by applying the VQSR procedure. The red SNPs didn't meet the given truth sensitivity threshold and so are filtered out of the call set. The lower left panel colors SNPs green, grey, and purple to give a sense of the distribution of the variants used to train the model. The green SNPs are those which were found in the training sets passed into the VariantRecalibrator step, while the purple SNPs are those which were found to be furthest away from the learned Gaussians and thus given the lowest probability of being true. Finally, the lower right panel colors each SNP by their known/novel status with blue being the known SNPs and red being the novel SNPs. Here the idea is to see if the annotation dimensions provide a clear separation between the known SNPs (most of which are true) and the novel SNPs (most of which are false).

An example of good clustering for SNP calls from the tutorial dataset is shown to the right. The plot shows that the training data forms a distinct cluster at low values for each of the two statistics shown (haplotype score and mapping quality bias). As the SNPs fall off the distribution in either one or both of the dimensions they are assigned a lower probability (that is, move into the red region of the model's PDF) and are filtered out. This makes sense as not only do higher values of HaplotypeScore indicate a lower chance of the data being explained by only two haplotypes but also higher values for mapping quality bias indicate more evidence of bias between the reference bases and the alternative bases. The model has captured our intuition that this area of the distribution is highly enriched for machine artifacts and putative variants here should be filtered out!

Tranches and the tranche plot

The recalibrated variant quality score provides a continuous estimate of the probability that each variant is true, allowing one to partition the call sets into quality tranches. The main purpose of the tranches is to establish thresholds within your data that correspond to certain levels of sensitivity relative to the truth sets. The idea is that with well calibrated variant quality scores, you can generate call sets in which each variant doesn't have to have a hard answer as to whether it is in or out of the set. If a very high accuracy call set is desired then one can use the highest tranche, but if a larger, more complete call set is a higher priority than one can dip down into lower and lower tranches. These tranches are applied to the output VCF file using the FILTER field. In this way you can choose to use some of the filtered records or only use the PASSing records.

The first tranche (from the bottom, with lowest values) is exceedingly specific but less sensitive, and each subsequent tranche in turn introduces additional true positive calls along with a growing number of false positive calls. Downstream applications can select in a principled way more specific or more sensitive call sets or incorporate directly the recalibrated quality scores to avoid entirely the need to analyze only a fixed subset of calls but rather weight individual variant calls by their probability of being real. An example tranche plot, automatically generated by the VariantRecalibrator walker, is shown below.

This is an example of a tranches plot generated for a HiSeq call set. The x-axis gives the number of novel variants called while the y-axis shows two quality metrics -- novel transition to transversion ratio and the overall truth sensitivity.

Note that the tranches plot is not applicable for indels.

Ti/Tv-free recalibration

We use a Ti/Tv-free approach to variant quality score recalibration. This approach requires an additional truth data set, and cuts the VQSLOD at given sensitivities to the truth set. It has several advantages over the Ti/Tv-targeted approach:

  • The truth sensitivity (TS) approach gives you back the novel Ti/Tv as a QC metric
  • The truth sensitivity (TS) approach is conceptual cleaner than deciding on a novel Ti/Tv target for your dataset
  • The TS approach is easier to explain and defend, as saying "I took called variants until I found 99% of my known variable sites" is easier than "I took variants until I dropped my novel Ti/Tv ratio to 2.07"

We have used hapmap 3.3 sites as the truth set (genotypes_r27_nr.b37_fwd.vcf), but other sets of high-quality (~99% truly variable in the population) sets of sites should work just as well. In our experience, with HapMap, 99% is a good threshold, as the remaining 1% of sites often exhibit unusual features like being close to indels or are actually MNPs, and so receive a low VQSLOD score.
Note that the expected Ti/Tv is still an available argument but it is only used for display purposes.

Finally, a couple of Frequently Asked Questions

- Can I use the variant quality score recalibrator with my small sequencing experiment?

This tool is expecting thousands of variant sites in order to achieve decent modeling with the Gaussian mixture model. Whole exome call sets work well, but anything smaller than that scale might run into difficulties.

One piece of advice is to turn down the number of Gaussians used during training. This can be accomplished by adding --maxGaussians 4 to your command line.

maxGaussians is the maximum number of different "clusters" (=Gaussians) of variants the program is "allowed" to try to identify. Lowering this number forces the program to group variants into a smaller number of clusters, which means there will be more variants in each cluster -- hopefully enough to satisfy the statistical requirements. Of course, this decreases the level of discrimination that you can achieve between variant profiles/error modes. It's all about trade-offs; and unfortunately if you don't have a lot of variants you can't afford to be very demanding in terms of resolution.

- Why don't all the plots get generated for me?

The most common problem related to this is not having Rscript accessible in your environment path. Rscript is the command line version of R that gets installed right alongside. We also make use of the ggplot2 library so please be sure to install that package as well.

Comments (5)


For a complete, detailed argument reference, refer to the GATK document page here.

The documentation for Using JEXL expressions within the GATK contains very important information about limitations of the filtering that can be done; in particular please note the section on working with complex expressions.

Filtering Individual Genotypes

One can now filter individual samples/genotypes in a VCF based on information from the FORMAT field: Variant Filtration will add the sample-level FT tag to the FORMAT field of filtered samples (this does not affect the record's FILTER tag). This is still a work in progress and isn't quite as flexible and powerful yet as we'd like it to be. For now, one can filter based on most fields as normal (e.g. GQ < 5.0), but the GT (genotype) field is an exception. We have put in convenience methods so that one can now filter out hets (isHet == 1), refs (isHomRef == 1), or homs (isHomVar == 1).


Comments (49)


Recalibrate variant quality scores and produce a callset filtered for the desired levels of sensitivity and specificity.


  • TBD


This document provides a typical usage example including parameter values. However, the values given may not be representative of the latest Best Practices recommendations. When in doubt, please consult the FAQ document on VQSR training sets and parameters, which overrides this document.


  1. Prepare recalibration parameters for SNPs
    a. Specify which call sets the program should use as resources to build the recalibration model
    b. Specify which annotations the program should use to evaluate the likelihood of Indels being real
    c. Specify the desired truth sensitivity threshold values that the program should use to generate tranches
    d. Determine additional model parameters

  2. Build the SNP recalibration model

  3. Apply the desired level of recalibration to the SNPs in the call set

  4. Prepare recalibration parameters for Indels a. Specify which call sets the program should use as resources to build the recalibration model b. Specify which annotations the program should use to evaluate the likelihood of Indels being real c. Specify the desired truth sensitivity threshold values that the program should use to generate tranches d. Determine additional model parameters

  5. Build the Indel recalibration model

  6. Apply the desired level of recalibration to the Indels in the call set

1. Prepare recalibration parameters for SNPs

a. Specify which call sets the program should use as resources to build the recalibration model

For each training set, we use key-value tags to qualify whether the set contains known sites, training sites, and/or truth sites. We also use a tag to specify the prior likelihood that those sites are true (using the Phred scale).

  • True sites training resource: HapMap

This resource is a SNP call set that has been validated to a very high degree of confidence. The program will consider that the variants in this resource are representative of true sites (truth=true), and will use them to train the recalibration model (training=true). We will also use these sites later on to choose a threshold for filtering variants based on sensitivity to truth sites. The prior likelihood we assign to these variants is Q15 (96.84%).

  • True sites training resource: Omni

This resource is a set of polymorphic SNP sites produced by the Omni genotyping array. The program will consider that the variants in this resource are representative of true sites (truth=true), and will use them to train the recalibration model (training=true). The prior likelihood we assign to these variants is Q12 (93.69%).

  • Non-true sites training resource: 1000G

This resource is a set of high-confidence SNP sites produced by the 1000 Genomes Project. The program will consider that the variants in this resource may contain true variants as well as false positives (truth=false), and will use them to train the recalibration model (training=true). The prior likelihood we assign to these variants is Q10 (%).

  • Known sites resource, not used in training: dbSNP

This resource is a SNP call set that has not been validated to a high degree of confidence (truth=false). The program will not use the variants in this resource to train the recalibration model (training=false). However, the program will use these to stratify output metrics such as Ti/Tv ratio by whether variants are present in dbsnp or not (known=true). The prior likelihood we assign to these variants is Q2 (36.90%).

The default prior likelihood assigned to all other variants is Q2 (36.90%). This low value reflects the fact that the philosophy of the GATK callers is to produce a large, highly sensitive callset that needs to be heavily refined through additional filtering.

b. Specify which annotations the program should use to evaluate the likelihood of Indels being real

These annotations are included in the information generated for each variant call by the caller. If an annotation is missing (typically because it was omitted from the calling command) it can be added using the VariantAnnotator tool.

  • Coverage (DP)

Total (unfiltered) depth of coverage.

  • QualByDepth (QD)

Variant confidence (from the QUAL field) / unfiltered depth of non-reference samples.

  • FisherStrand (FS)

Phred-scaled p-value using Fisher's Exact Test to detect strand bias (the variation being seen on only the forward or only the reverse strand) in the reads. More bias is indicative of false positive calls.

  • MappingQualityRankSumTest (MQRankSum)

The u-based z-approximation from the Mann-Whitney Rank Sum Test for mapping qualities (reads with ref bases vs. those with the alternate allele). Note that the mapping quality rank sum test can not be calculated for sites without a mixture of reads showing both the reference and alternate alleles.

  • ReadPosRankSumTest (ReadPosRankSum)

The u-based z-approximation from the Mann-Whitney Rank Sum Test for the distance from the end of the read for reads with the alternate allele. If the alternate allele is only seen near the ends of reads, this is indicative of error. Note that the read position rank sum test can not be calculated for sites without a mixture of reads showing both the reference and alternate alleles.

c. Specify the desired truth sensitivity threshold values that the program should use to generate tranches

  • First tranche threshold 100.0

  • Second tranche threshold 99.9

  • Third tranche threshold 99.0

  • Fourth tranche threshold 90.0

Tranches are essentially slices of variants, ranked by VQSLOD, bounded by the threshold values specified in this step. The threshold values themselves refer to the sensitivity we can obtain when we apply them to the call sets that the program uses to train the model. The idea is that the lowest tranche is highly specific but less sensitive (there are very few false positives but potentially many false negatives, i.e. missing calls), and each subsequent tranche in turn introduces additional true positive calls along with a growing number of false positive calls. This allows us to filter variants based on how sensitive we want the call set to be, rather than applying hard filters and then only evaluating how sensitive the call set is using post hoc methods.

2. Build the SNP recalibration model


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T VariantRecalibrator \ 
    -R reference.fa \ 
    -input raw_variants.vcf \ 
    -resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap.vcf \ 
    -resource:omni,known=false,training=true,truth=true,prior=12.0 omni.vcf \ 
    -resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G.vcf \ 
    -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp.vcf \ 
    -an DP \ 
    -an QD \ 
    -an FS \ 
    -an MQRankSum \ 
    -an ReadPosRankSum \ 
    -mode SNP \ 
    -tranche 100.0 -tranche 99.9 -tranche 99.0 -tranche 90.0 \ 
    -recalFile recalibrate_SNP.recal \ 
    -tranchesFile recalibrate_SNP.tranches \ 
    -rscriptFile recalibrate_SNP_plots.R 

Expected Result

This creates several files. The most important file is the recalibration report, called recalibrate_SNP.recal, which contains the recalibration data. This is what the program will use in the next step to generate a VCF file in which the variants are annotated with their recalibrated quality scores. There is also a file called recalibrate_SNP.tranches, which contains the quality score thresholds corresponding to the tranches specified in the original command. Finally, if your installation of R and the other required libraries was done correctly, you will also find some PDF files containing plots. These plots illustrated the distribution of variants according to certain dimensions of the model.

For detailed instructions on how to interpret these plots, please refer to the online GATK documentation.

3. Apply the desired level of recalibration to the SNPs in the call set


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T ApplyRecalibration \ 
    -R reference.fa \ 
    -input raw_variants.vcf \ 
    -mode SNP \ 
    --ts_filter_level 99.0 \ 
    -recalFile recalibrate_SNP.recal \ 
    -tranchesFile recalibrate_SNP.tranches \ 
    -o recalibrated_snps_raw_indels.vcf 

Expected Result

This creates a new VCF file, called recalibrated_snps_raw_indels.vcf, which contains all the original variants from the original raw_variants.vcf file, but now the SNPs are annotated with their recalibrated quality scores (VQSLOD) and either PASS or FILTER depending on whether or not they are included in the selected tranche.

Here we are taking the second lowest of the tranches specified in the original recalibration command. This means that we are applying to our data set the level of sensitivity that would allow us to retrieve 99% of true variants from the truth training sets of HapMap and Omni SNPs. If we wanted to be more specific (and therefore have less risk of including false positives, at the risk of missing real sites) we could take the very lowest tranche, which would only retrieve 90% of the truth training sites. If we wanted to be more sensitive (and therefore less specific, at the risk of including more false positives) we could take the higher tranches. In our Best Practices documentation, we recommend taking the second highest tranche (99.9%) which provides the highest sensitivity you can get while still being acceptably specific.

4. Prepare recalibration parameters for Indels

a. Specify which call sets the program should use as resources to build the recalibration model

For each training set, we use key-value tags to qualify whether the set contains known sites, training sites, and/or truth sites. We also use a tag to specify the prior likelihood that those sites are true (using the Phred scale).

  • Known and true sites training resource: Mills

This resource is an Indel call set that has been validated to a high degree of confidence. The program will consider that the variants in this resource are representative of true sites (truth=true), and will use them to train the recalibration model (training=true). The prior likelihood we assign to these variants is Q12 (93.69%).

The default prior likelihood assigned to all other variants is Q2 (36.90%). This low value reflects the fact that the philosophy of the GATK callers is to produce a large, highly sensitive callset that needs to be heavily refined through additional filtering.

b. Specify which annotations the program should use to evaluate the likelihood of Indels being real

These annotations are included in the information generated for each variant call by the caller. If an annotation is missing (typically because it was omitted from the calling command) it can be added using the VariantAnnotator tool.

  • Coverage (DP)

Total (unfiltered) depth of coverage.

  • FisherStrand (FS)

Phred-scaled p-value using Fisher's Exact Test to detect strand bias (the variation being seen on only the forward or only the reverse strand) in the reads. More bias is indicative of false positive calls.

  • MappingQualityRankSumTest (MQRankSum)

The u-based z-approximation from the Mann-Whitney Rank Sum Test for mapping qualities (reads with ref bases vs. those with the alternate allele). Note that the mapping quality rank sum test can not be calculated for sites without a mixture of reads showing both the reference and alternate alleles.

  • ReadPosRankSumTest (ReadPosRankSum)

The u-based z-approximation from the Mann-Whitney Rank Sum Test for the distance from the end of the read for reads with the alternate allele. If the alternate allele is only seen near the ends of reads, this is indicative of error. Note that the read position rank sum test can not be calculated for sites without a mixture of reads showing both the reference and alternate alleles.

c. Specify the desired truth sensitivity threshold values that the program should use to generate tranches

  • First tranche threshold 100.0

  • Second tranche threshold 99.9

  • Third tranche threshold 99.0

  • Fourth tranche threshold 90.0

Tranches are essentially slices of variants, ranked by VQSLOD, bounded by the threshold values specified in this step. The threshold values themselves refer to the sensitivity we can obtain when we apply them to the call sets that the program uses to train the model. The idea is that the lowest tranche is highly specific but less sensitive (there are very few false positives but potentially many false negatives, i.e. missing calls), and each subsequent tranche in turn introduces additional true positive calls along with a growing number of false positive calls. This allows us to filter variants based on how sensitive we want the call set to be, rather than applying hard filters and then only evaluating how sensitive the call set is using post hoc methods.

d. Determine additional model parameters

  • Maximum number of Gaussians (-maxGaussians) 4

This is the maximum number of Gaussians (i.e. clusters of variants that have similar properties) that the program should try to identify when it runs the variational Bayes algorithm that underlies the machine learning method. In essence, this limits the number of different ”profiles” of variants that the program will try to identify. This number should only be increased for datasets that include very many variants.

5. Build the Indel recalibration model


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T VariantRecalibrator \ 
    -R reference.fa \ 
    -input recalibrated_snps_raw_indels.vcf \ 
    -resource:mills,known=true,training=true,truth=true,prior=12.0 mills.vcf \ 
    -an DP \ 
    -an FS \ 
    -an MQRankSum \ 
    -an ReadPosRankSum \ 
    -mode INDEL \ 
    -tranche 100.0 -tranche 99.9 -tranche 99.0 -tranche 90.0 \ 
    --maxGaussians 4 \ 
    -recalFile recalibrate_INDEL.recal \ 
    -tranchesFile recalibrate_INDEL.tranches \ 
    -rscriptFile recalibrate_INDEL_plots.R 

Expected Result

This creates several files. The most important file is the recalibration report, called recalibrate_INDEL.recal, which contains the recalibration data. This is what the program will use in the next step to generate a VCF file in which the variants are annotated with their recalibrated quality scores. There is also a file called recalibrate_INDEL.tranches, which contains the quality score thresholds corresponding to the tranches specified in the original command. Finally, if your installation of R and the other required libraries was done correctly, you will also find some PDF files containing plots. These plots illustrated the distribution of variants according to certain dimensions of the model.

For detailed instructions on how to interpret these plots, please refer to the online GATK documentation.

6. Apply the desired level of recalibration to the Indels in the call set


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T ApplyRecalibration \ 
    -R reference.fa \ 
    -input recalibrated_snps_raw_indels.vcf \ 
    -mode INDEL \ 
    --ts_filter_level 99.0 \ 
    -recalFile recalibrate_INDEL.recal \ 
    -tranchesFile recalibrate_INDEL.tranches \ 
    -o recalibrated_variants.vcf 

Expected Result

This creates a new VCF file, called recalibrated_variants.vcf, which contains all the original variants from the original recalibrated_snps_raw_indels.vcf file, but now the Indels are also annotated with their recalibrated quality scores (VQSLOD) and either PASS or FILTER depending on whether or not they are included in the selected tranche.

Here we are taking the second lowest of the tranches specified in the original recalibration command. This means that we are applying to our data set the level of sensitivity that would allow us to retrieve 99% of true variants from the truth training sets of HapMap and Omni SNPs. If we wanted to be more specific (and therefore have less risk of including false positives, at the risk of missing real sites) we could take the very lowest tranche, which would only retrieve 90% of the truth training sites. If we wanted to be more sensitive (and therefore less specific, at the risk of including more false positives) we could take the higher tranches. In our Best Practices documentation, we recommend taking the second highest tranche (99.9%) which provides the highest sensitivity you can get while still being acceptably specific.

Comments (17)


Apply hard filters to a variant callset that is too small for VQSR or for which truth/training sets are not available.


  • TBD


  1. Extract the SNPs from the call set
  2. Determine parameters for filtering SNPs
  3. Apply the filter to the SNP call set
  4. Extract the Indels from the call set
  5. Determine parameters for filtering SNPs
  6. Apply the filter to the Indel call set

1. Extract the SNPs from the call set


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T SelectVariants \ 
    -R reference.fa \ 
    -V raw_variants.vcf \ 
    -L 20 \ 
    -selectType SNP \ 
    -o raw_snps.vcf 

Expected Result

This creates a VCF file called raw_snps.vcf, containing just the SNPs from the original file of raw variants.

2. Determine parameters for filtering SNPs

SNPs matching any of these conditions will be considered bad and filtered out, i.e. marked FILTER in the output VCF file. The program will specify which parameter was chiefly responsible for the exclusion of the SNP using the culprit annotation. SNPs that do not match any of these conditions will be considered good and marked PASS in the output VCF file.

  • QualByDepth (QD) 2.0

This is the variant confidence (from the QUAL field) divided by the unfiltered depth of non-reference samples.

  • FisherStrand (FS) 60.0

Phred-scaled p-value using Fisher’s Exact Test to detect strand bias (the variation being seen on only the forward or only the reverse strand) in the reads. More bias is indicative of false positive calls.

  • RMSMappingQuality (MQ) 40.0

This is the Root Mean Square of the mapping quality of the reads across all samples.

  • HaplotypeScore 13.0

This is the consistency of the site with two (and only two) segregating haplotypes. Note that this is not applicable for calls made using the UnifiedGenotyper on non-diploid organisms.

  • MappingQualityRankSumTest (MQRankSum) 12.5

This is the u-based z-approximation from the Mann-Whitney Rank Sum Test for mapping qualities (reads with ref bases vs. those with the alternate allele). Note that the mapping quality rank sum test can not be calculated for sites without a mixture of reads showing both the reference and alternate alleles, i.e. this will only be applied to heterozygous calls.

  • ReadPosRankSumTest (ReadPosRankSum) 8.0

This is the u-based z-approximation from the Mann-Whitney Rank Sum Test for the distance from the end of the read for reads with the alternate allele. If the alternate allele is only seen near the ends of reads, this is indicative of error. Note that the read position rank sum test can not be calculated for sites without a mixture of reads showing both the reference and alternate alleles, i.e. this will only be applied to heterozygous calls.

3. Apply the filter to the SNP call set


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T VariantFiltration \ 
    -R reference.fa \ 
    -V raw_snps.vcf \ 
    --filterExpression "QD < 2.0 || FS > 60.0 || MQ < 40.0 || HaplotypeScore > 13.0 || MappingQualityRankSum < -12.5 || ReadPosRankSum < -8.0" \ 
    --filterName "my_snp_filter" \ 
    -o filtered_snps.vcf 

Expected Result

This creates a VCF file called filtered_snps.vcf, containing all the original SNPs from the raw_snps.vcf file, but now the SNPs are annotated with either PASS or FILTER depending on whether or not they passed the filters.

For SNPs that failed the filter, the variant annotation also includes the name of the filter. That way, if you apply several different filters (simultaneously or sequentially), you can keep track of which filter(s) each SNP failed, and later you can retrieve specific subsets of your calls using the SelectVariants tool. To learn more about composing different types of filtering expressions and retrieving subsets of variants using SelectVariants, please see the online GATK documentation.

4. Extract the Indels from the call set


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T SelectVariants \ 
    -R reference.fa \ 
    -V raw_HC_variants.vcf \ 
    -L 20 \ 
    -selectType INDEL \ 
    -o raw_indels.vcf 

Expected Result

This creates a VCF file called raw_indels.vcf, containing just the Indels from the original file of raw variants.

5. Determine parameters for filtering Indels.

Indels matching any of these conditions will be considered bad and filtered out, i.e. marked FILTER in the output VCF file. The program will specify which parameter was chiefly responsible for the exclusion of the indel using the culprit annotation. Indels that do not match any of these conditions will be considered good and marked PASS in the output VCF file.

  • QualByDepth (QD) 2.0

This is the variant confidence (from the QUAL field) divided by the unfiltered depth of non-reference samples.

  • FisherStrand (FS) 200.0

Phred-scaled p-value using Fisher’s Exact Test to detect strand bias (the variation being seen on only the forward or only the reverse strand) in the reads. More bias is indicative of false positive calls.

  • ReadPosRankSumTest (ReadPosRankSum) 20.0

This is the u-based z-approximation from the Mann-Whitney Rank Sum Test for the distance from the end of the read for reads with the alternate allele. If the alternate allele is only seen near the ends of reads, this is indicative of error. Note that the read position rank sum test can not be calculated for sites without a mixture of reads showing both the reference and alternate alleles, i.e. this will only be applied to heterozygous calls.

6. Apply the filter to the Indel call set


Run the following GATK command:

java -jar GenomeAnalysisTK.jar \ 
    -T VariantFiltration \ 
    -R reference.fa \ 
    -V raw_indels.vcf \ 
    --filterExpression "QD < 2.0 || FS > 200.0 || ReadPosRankSum < -20.0" \ 
    --filterName "my_indel_filter" \ 
    -o filtered_indels.vcf 

Expected Result

This creates a VCF file called filtered_indels.vcf, containing all the original Indels from the raw_indels.vcf file, but now the Indels are annotated with either PASS or FILTER depending on whether or not they passed the filters.

For Indels that failed the filter, the variant annotation also includes the name of the filter. That way, if you apply several different filters (simultaneously or sequentially), you can keep track of which filter(s) each Indel failed, and later you can retrieve specific subsets of your calls using the SelectVariants tool. To learn more about composing different types of filtering expressions and retrieving subsets of variants using SelectVariants, please see the online GATK documentation.

Frequently Asked Questions

Comments (102)

This document describes the resource datasets and arguments to use in the two steps of VQSR (i.e. the successive application of VariantRecalibrator and ApplyRecalibration), based on our work with human genomes.

Note that VQSR must be run twice in succession in order to build a separate error model for SNPs and INDELs (see the VQSR documentation for more details).

These recommendations are valid for use with calls generated by both the UnifiedGenotyper and HaplotypeCaller. In the past we made a distinction in how we processed the calls from these two callers, but now we treat them the same way. These recommendations will probably not work properly on calls generated by other (non-GATK) callers.

Resource datasets

The human genome training, truth and known resource datasets mentioned in this document are all available from our resource bundle.

If you are working with non-human genomes, you will need to find or generate at least truth and training resource datasets with properties corresponding to those described below. To generate your own resource set, one idea is to first do an initial round of SNP calling and only use those SNPs which have the highest quality scores. These sites which have the most confidence are probably real and could be used as truth data to help disambiguate the rest of the variants in the call set. Another idea is to try using several SNP callers in addition to the UnifiedGenotyper or HaplotypeCaller, and use those sites which are concordant between the different methods as truth data. In either case, you'll need to assign your set a prior likelihood that reflects your confidence in how reliable it is as a truth set. We recommend Q10 as a starting value, which you can then experiment with to find the most appropriate value empirically. There are many possible avenues of research here. Hopefully the model reporting plots that are generated by the recalibration tools will help facilitate this experimentation.

Resources for SNPs

  • True sites training resource: HapMap

    This resource is a SNP call set that has been validated to a very high degree of confidence. The program will consider that the variants in this resource are representative of true sites (truth=true), and will use them to train the recalibration model (training=true). We will also use these sites later on to choose a threshold for filtering variants based on sensitivity to truth sites. The prior likelihood we assign to these variants is Q15 (96.84%).

  • True sites training resource: Omni

    This resource is a set of polymorphic SNP sites produced by the Omni geno- typing array. The program will consider that the variants in this resource are representative of true sites (truth=true), and will use them to train the recalibration model (training=true). The prior likelihood we assign to these variants is Q12 (93.69%).

  • Non-true sites training resource: 1000G
    This resource is a set of high-confidence SNP sites produced by the 1000 Genomes Project. The program will consider that the variants in this re- source may contain true variants as well as false positives (truth=false), and will use them to train the recalibration model (training=true). The prior likelihood we assign to these variants is Q10 (%). 17

  • Known sites resource, not used in training: dbSNP
    This resource is a call set that has not been validated to a high degree of confidence (truth=false). The program will not use the variants in this resource to train the recalibration model (training=false). However, the program will use these to stratify output metrics such as Ti/Tv ratio by whether variants are present in dbsnp or not (known=true). The prior likelihood we assign to these variants is Q2 (36.90%).

Resources for Indels

  • Known and true sites training resource: Mills
    This resource is an Indel call set that has been validated to a high degree of confidence. The program will consider that the variants in this resource are representative of true sites (truth=true), and will use them to train the recalibration model (training=true). The prior likelihood we assign to these variants is Q12 (93.69%).


The variant quality score recalibrator builds an adaptive error model using known variant sites and then applies this model to estimate the probability that each variant is a true genetic variant or a machine artifact. One major improvement from previous recommended protocols is that hand filters do not need to be applied at any point in the process now. All filtering criteria are learned from the data itself.

Common, base command line

java -Xmx4g -jar GenomeAnalysisTK.jar \
   -T VariantRecalibrator \
   -R path/to/reference/human_g1k_v37.fasta \
   -input raw.input.vcf \
   -recalFile path/to/output.recal \
   -tranchesFile path/to/output.tranches \
   -nt 4 \

SNP specific recommendations

For SNPs we use both HapMap v3.3 and the Omni chip array from the 1000 Genomes Project as training data. In addition we take the highest confidence SNPs from the project's callset. These datasets are available in the GATK resource bundle.

Arguments for VariantRecalibrator command:

   -resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.b37.sites.vcf \
   -resource:omni,known=false,training=true,truth=true,prior=12.0 1000G_omni2.5.b37.sites.vcf \
   -resource:1000G,known=false,training=true,truth=false,prior=10.0 1000G_phase1.snps.high_confidence.vcf \
   -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp.b37.vcf \
   -an QD -an MQ -an MQRankSum -an ReadPosRankSum -an FS -an DP -an InbreedingCoeff \
   -mode SNP \

Please note that these recommendations are formulated for whole-genome datasets. For exomes, we do not recommend using DP for variant recalibration (see below for details of why).

Note also that, for the above to work, the input vcf needs to be annotated with the corresponding values (QD, FS, DP, etc.). If any of these values are somehow missing, then VariantAnnotator needs to be run first so that VariantRecalibration can run properly.

Also, using the provided sites-only truth data files is important here as parsing the genotypes for VCF files with many samples increases the runtime of the tool significantly.

You may notice that these recommendations no longer include the --numBadVariants argument. That is because we have removed this argument from the tool, as the VariantRecalibrator now determines the number of variants to use for modeling "bad" variants internally based on the data.

Important notes about annotations

Some of these annotations might not be the best for your particular dataset.

Depth of coverage (the DP annotation invoked by Coverage) should not be used when working with exome datasets since there is extreme variation in the depth to which targets are captured! In whole genome experiments this variation is indicative of error but that is not the case in capture experiments.

Additionally, the UnifiedGenotyper produces a statistic called the HaplotypeScore which should be used for SNPs. This statistic isn't necessary for the HaplotypeCaller because that mathematics is already built into the likelihood function itself when calling full haplotypes.

The InbreedingCoeff is a population level statistic that requires at least 10 samples in order to be computed. For projects with fewer samples please omit this annotation from the command line.

Important notes for exome capture experiments

In our testing we've found that in order to achieve the best exome results one needs to use an exome SNP and/or indel callset with at least 30 samples. For users with experiments containing fewer exome samples there are several options to explore:

  • Add additional samples for variant calling, either by sequencing additional samples or using publicly available exome bams from the 1000 Genomes Project (this option is used by the Broad exome production pipeline)
  • Use the VQSR with the smaller variant callset but experiment with the precise argument settings (try adding --maxGaussians 4 to your command line, for example)

Indel specific recommendations

When modeling indels with the VQSR we use a training dataset that was created at the Broad by strictly curating the (Mills, Devine, Genome Research, 2011) dataset as as well as adding in very high confidence indels from the 1000 Genomes Project. This dataset is available in the GATK resource bundle.

Arguments for VariantRecalibrator:

   --maxGaussians 4 \
   -resource:mills,known=false,training=true,truth=true,prior=12.0 Mills_and_1000G_gold_standard.indels.b37.sites.vcf \
   -resource:dbsnp,known=true,training=false,truth=false,prior=2.0 dbsnp.b37.vcf \
   -an QD -an DP -an FS -an ReadPosRankSum -an MQRankSum -an InbreedingCoeff \
   -mode INDEL \

Note that indels use a different set of annotations than SNPs. Most annotations related to mapping quality have been removed since there is a conflation with the length of an indel in a read and the degradation in mapping quality that is assigned to the read by the aligner. This covariation is not necessarily indicative of being an error in the same way that it is for SNPs.

You may notice that these recommendations no longer include the --numBadVariants argument. That is because we have removed this argument from the tool, as the VariantRecalibrator now determines the number of variants to use for modeling "bad" variants internally based on the data.


The power of the VQSR is that it assigns a calibrated probability to every putative mutation in the callset. The user is then able to decide at what point on the theoretical ROC curve their project wants to live. Some projects, for example, are interested in finding every possible mutation and can tolerate a higher false positive rate. On the other hand, some projects want to generate a ranked list of mutations that they are very certain are real and well supported by the underlying data. The VQSR provides the necessary statistical machinery to effectively apply this sensitivity/specificity tradeoff.

Common, base command line

 java -Xmx3g -jar GenomeAnalysisTK.jar \
   -T ApplyRecalibration \
   -R reference/human_g1k_v37.fasta \
   -input raw.input.vcf \
   -tranchesFile path/to/input.tranches \
   -recalFile path/to/input.recal \
   -o path/to/output.recalibrated.filtered.vcf \

SNP specific recommendations

For SNPs we used HapMap 3.3 and the Omni 2.5M chip as our truth set. We typically seek to achieve 99.5% sensitivity to the accessible truth sites, but this is by no means universally applicable: you will need to experiment to find out what tranche cutoff is right for your data. Generally speaking, projects involving a higher degree of diversity in terms of world populations can expect to achieve a higher truth sensitivity than projects with a smaller scope.

   --ts_filter_level 99.5 \
   -mode SNP \

Indel specific recommendations

For indels we use the Mills / 1000 Genomes indel truth set described above. We typically seek to achieve 99.0% sensitivity to the accessible truth sites, but this is by no means universally applicable: you will need to experiment to find out what tranche cutoff is right for your data. Generally speaking, projects involving a higher degree of diversity in terms of world populations can expect to achieve a higher truth sensitivity than projects with a smaller scope.

   --ts_filter_level 99.0 \
   -mode INDEL \
Comments (0)

As featured in this forum question.

Two main things account for these kinds of differences, both linked to default behaviors of the tools:

  • The tools downsample to different depths of coverage

  • The tools apply different read filters

In both cases, you can end up looking at different sets or numbers of reads, which causes some of the annotation values to be different. It's usually not a cause for alarm. Remember that many of these annotations should be interpreted relatively, not absolutely.

Comments (35)

If you are sure that you cannot use VQSR / recalibrate variants (typically because your dataset is too small, or because there are no truth/training resources available for your organism), then you will need to use the VariantFiltration tool to manually filter your variants. To do this, you will need to compose filter expressions as explained here, here and here based on the recommendations detailed further below.

But first, some caveats

Let's be painfully clear about this: there is no magic formula that will give you perfect results. Filtering variants manually, using thresholds on annotation values, is subject to all sorts of caveats. The appropriateness of both the annotations and the threshold values is very highly dependent on the specific callset, how it was called, what the data was like, etc.

HOWEVER, because we want to help and people always say that something is better than nothing (not necessarily true, but let's go with that for now), we have formulated some generic recommendations that should at least provide a starting point for people to experiment with their data.

In case you didn't catch that bit in bold there, we're saying that you absolutely SHOULD NOT expect to run these commands and be done with your analysis. You absolutely SHOULD expect to have to evaluate your results critically and TRY AGAIN with some parameter adjustments until you find the settings that are right for your data.

In addition, please note that these recommendations are mainly designed for dealing with very small data sets (in terms of both number of samples or size of targeted regions). If you are not using VQSR because you do not have training/truth resources available for your organism, then you should expect to have to do even more tweaking on the filtering parameters.

So, here are some recommended arguments to use with VariantFiltration when ALL other options are unavailable to you:

Filtering recommendations for SNPs:

  • QD < 2.0
  • MQ < 40.0
  • FS > 60.0
  • HaplotypeScore > 13.0
  • MQRankSum < -12.5
  • ReadPosRankSum < -8.0

Filtering recommendations for indels:

  • QD < 2.0
  • ReadPosRankSum < -20.0
  • InbreedingCoeff < -0.8
  • FS > 200.0

And now some more IMPORTANT caveats (don't skip this!)

  • The InbreedingCoeff statistic is a population-level calculation that is only available with 10 or more samples. If you have fewer samples you will need to omit that particular filter statement.

  • For shallow-coverage (<10x), it is virtually impossible to use manual filtering to reliably separate true positives from false positives. You really, really, really should use the protocol involving variant quality score recalibration. If you can't do that, maybe you need to take a long hard look at your experimental design. In any case you're probably in for a world of pain.

  • The maximum DP (depth) filter only applies to whole genome data, where the probability of a site having exactly N reads given an average coverage of M is a well-behaved function. First principles suggest this should be a binomial sampling but in practice it is more a Gaussian distribution. Regardless, the DP threshold should be set a 5 or 6 sigma from the mean coverage across all samples, so that the DP > X threshold eliminates sites with excessive coverage caused by alignment artifacts. Note that for exomes, a straight DP filter shouldn't be used because the relationship between misalignments and depth isn't clear for capture data.

Finally, a note of hope

Some bits of this article may seem harsh, or depressing. Sorry. We believe in giving you the cold hard truth.

HOWEVER, we do understand that this is one of the major points of pain that GATK users encounter -- along with understanding how VQSR works, so really, whichever option you go with, you're going to suffer.

And we do genuinely want to help. So although we can't look at every single person's callset and give an opinion on how it looks (no, seriously, don't ask us to do that), we do want to hear from you about how we can best help you help yourself. What information do you feel would help you make informed decisions about how to set parameters? Are the meanings of the annotations not clear? Would knowing more about how they are computed help you understand how you can use them? Do you want more math? Less math, more concrete examples?

Tell us what you'd like to see here, and we'll do our best to make it happen. (no unicorns though, we're out of stock)

We also welcome testimonials from you. We are one small team; you are a legion of analysts all trying different things. Please feel free to come forward and share your findings on what works particularly well in your hands.

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Suggested Preliminary Analyses Overview

Once you have generated and filtered your callset according to our recommendations, you have several options for evaluating and refining the variant and genotype calls further, before moving on with your study. We do not provide comprehensive guidelines for this step because different studies will have different requirements, but we do provide tools and general advice.

The main options available through GATK are:

  • Genotype Refinement
  • Functional Annotation
  • Variant Evaluation

Some of the tools involved in those processes (such as SnpEff and BEAGLE) are third-party tools that are not part of GATK. We recommend those specific tools because we are most familiar with them, but there may be alternative software that would work just as well or even better with your particular data. Also, please understand that we cannot provide support for those tools; if you have any problems with them we suggest you seek out the corresponding documentation form the tool project websites, and contact their developers with any questions you may have.

Frequently Asked Questions

Comments (77)

This document describes "regular" (variants-only) VCF files. For information on the gVCF format produced by HaplotypeCaller in -ERC GVCF mode, please see this companion document.

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence indicated by GQ = 25.92 isn't so good, largely because there were only a total of 4 reads at this site (DP =4), 1 of which was REF (=had the reference base) and 3 of which were ALT (=had the alternate base) (indicated by AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value that corresponds to a likelihood of 1.0). There's a chance that the subject is "hom-var" (=homozygous with the variant allele) since PL(1/1) = 26, which corresponds to 10^(-2.6), or 0.0025, but either way, it's clear that the subject is definitely not "hom-ref" (=homozygous with the reference allele) since PL(0/0) = 103, which corresponds to 10^(-10.3), a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).
Comments (15)

New WGS and WEx CEU trio BAM files

We have sequenced at the Broad Institute and released to the 1000 Genomes Project the following datasets for the three members of the CEU trio (NA12878, NA12891 and NA12892):

  • WEx (150x) sequence
  • WGS (>60x) sequence

This is better data to work with than the original DePristo et al. BAMs files, so we recommend you download and analyze these files if you are looking for complete, large-scale data sets to evaluate the GATK or other tools.

Here's the rough library properties of the BAMs:

CEU trio BAM libraries

These data files can be downloaded from the 1000 Genomes DCC

NA12878 Datasets from DePristo et al. (2011) Nature Genetics

Here are the datasets we used in the GATK paper cited below.

DePristo M, Banks E, Poplin R, Garimella K, Maguire J, Hartl C, Philippakis A, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell T, Kernytsky A, Sivachenko A, Cibulskis K, Gabriel S, Altshuler D and Daly, M (2011). A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nature Genetics. 43:491-498.

Some of the BAM and VCF files are currently hosted by the NCBI:

  • NA12878.hiseq.wgs.bwa.recal.bam -- BAM file for NA12878 HiSeq whole genome
  • NA12878.hiseq.wgs.bwa.raw.bam Raw reads (in BAM format, see below)
  • NA12878.ga2.exome.maq.recal.bam -- BAM file for NA12878 GenomeAnalyzer II whole exome (hg18)
  • NA12878.ga2.exome.maq.raw.bam Raw reads (in BAM format, see below)
  • NA12878.hiseq.wgs.vcf.gz -- SNP calls for NA12878 HiSeq whole genome (hg18)
  • NA12878.ga2.exome.vcf.gz -- SNP calls for NA12878 GenomeAnalyzer II whole exome (hg18)
  • BAM files for CEU + NA12878 whole genome (b36). These are the standard BAM files for the 1000 Genomes pilot CEU samples plus a 4x downsampled version of NA12878 from the pilot 2 data set, available in the DePristoNatGenet2011 directory of the GSA FTP Server
  • SNP calls for CEU + NA12878 whole genome (b36) are available in the DePristoNatGenet2011 directory of the GSA FTP Server
  • Crossbow comparison SNP calls are available in the DePristoNatGenet2011 directory of the GSA FTP Server as crossbow.filtered.vcf. The raw calls can be viewed by ignoring the FILTER field status
  • whole_exome_agilent_designed_120.Homo_sapiens_assembly18.targets.interval_list -- targets used in the analysis of the exome capture data

Please note that we have not collected the indel calls for the paper, as these are only used for filtering SNPs near indels. If you want to call accurate indels, please use the new GATK indel caller in the Unified Genotyper.


Both the GATK and the sequencing technologies have improved significantly since the analyses performed in this paper.

  • If you are conducting a review today, we would recommend that the newest version of the GATK, which performs much better than the version described in the paper. Moreover, we would also recommend one use the newest version of Crossbow as well, in case they have improved things. The GATK calls for NA12878 from the paper (above) will give one a good idea what a good call set looks like whole-genome or whole-exome.

  • The data sets used in the paper are no longer state-of-the-art. The WEx BAM is GAII data aligned with MAQ on hg18, but a state-of-the-art data set would use HiSeq and BWA on hg19. Even the 64x HiSeq WG data set is already more than one year old. For a better assessment, we would recommend you use a newer data set for these samples, if you have the capacity to generate it. This applies less to the WG NA12878 data, which is pretty good, but the NA12878 WEx from the paper is nearly 2 years old now and notably worse than our most recent data sets.

Obviously, this was an annoyance for us as well, as it would have been nice to use a state-of-the-art data set for the WEx. But we decided to freeze the data used for analysis to actually finish this paper.

How do I get the raw FASTQ file from a BAM?

If you want the raw, machine output for the data analyzed in the GATK framework paper, obtain the raw BAM files above and convert them from SAM to FASTQ using the Picard tool SamToFastq.

Comments (10)

Just because something looks like a SNP in IGV doesn't mean that it is of high quality. We are extremely confident in the genotype likelihoods calculations in the Unified Genotyper (especially for SNPs) and in the HaplotypeCaller (for all variants including indels). So, before you post this issue in our support forum, please do a little bit of investigation on your own, as follows.

To diagnose what is happening, you should take a look at the pileup of bases at the position in question. It is very important for you to look at the underlying data here.

Here is a checklist of questions you should ask yourself:

  • How many overlapping deletions are there at the position?

The genotyper ignores sites if there are too many overlapping deletions. This value can be set using the --max_deletion_fraction argument (see the UG's documentation page to find out what is the default value for this argument), but be aware that increasing it could affect the reliability of your results.

  • What do the base qualities look like for the non-reference bases?

Remember that there is a minimum base quality threshold and that low base qualities mean that the sequencer assigned a low confidence to that base. If your would-be SNP is only supported by low-confidence bases, it is probably a false positive.

Keep in mind that the depth reported in the VCF is the unfiltered depth. You may think you have good coverage at that site, but the Unified Genotyper ignores bases if they don't look good, so actual coverage seen by the UG may be lower than you think.

  • What do the mapping qualities look like for the reads with the non-reference bases?

A base's quality is capped by the mapping quality of its read. The reason for this is that low mapping qualities mean that the aligner had little confidence that the read is mapped to the correct location in the genome. You may be seeing mismatches because the read doesn't belong there -- you may be looking at the sequence of some other locus in the genome!

Keep in mind also that reads with mapping quality 255 ("unknown") are ignored.

  • Are there a lot of alternate alleles?

By default the UG will only consider a certain number of alternate alleles. This value can be set using the --max_alternate_alleles argument (see the UG's documentation page to find out what is the default value for this argument). Note however that genotyping sites with many alternate alleles is both CPU and memory intensive and it scales exponentially based on the number of alternate alleles. Unless there is a good reason to change the default value, we highly recommend that you not play around with this parameter.

  • Are you working with SOLiD data?

SOLiD alignments tend to have reference bias and it can be severe in some cases. Do the SOLiD reads have a lot of mismatches (no-calls count as mismatches) around the the site? If so, you are probably seeing false positives.

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Genotype Refinement

Once you have identified variant sites in your data and assigned genotypes for each sample at those sites, it can be useful to further refine the genotypes, e.g. by phasing, by imputation, and by identifying Mendelian violations. The GATK includes tools for phasing and identifying Mendelian violations, but does not include imputation tools. However, we do provide conversion tools to interface with BEAGLE, a popular imputation tool developed at Washington University.


Comments (27)


To call variants with the GATK using pedigree information, you should base your workflow on the Best Practices recommendations -- the principles detailed there all apply to pedigree analysis.

But there is one crucial addition: you should make sure to pass a pedigree file (PED file) to all GATK walkers that you use in your workflow. Some will deliver better results if they see the pedigree data.

At the moment there are two of the standard annotations affected by pedigree:

  • Allele Frequency (computed on founders only)
  • Inbreeding coefficient (computed on founders only)

Note that you will need at least 10 founders to compute the inbreeding coefficient.

Trio Analysis

In the specific case of trios, an additional GATK walker, PhaseByTransmission, should be used to obtain trio-aware genotypes as well as phase by descent.

Important note

The annotations mentioned above have been adapted for PED files starting with GATK v.1.6. If you already have VCF files generated by an older version of the GATK or have not passed a PED file while running the UnifiedGenotyper or VariantAnnotator, you should do the following:

  • Run the latest version of the VariantAnnotator to re-annotate your variants.
  • Re-annotate all the standard annotations by passing the argument -G StandardAnnotation to VariantAnnotator. Make sure you pass your PED file to the VariantAnnotator as well!
  • If you are using Variant Quality Score Recalibration (VQSR) with the InbreedingCoefficient as an annotation in your model, you should re-run VQSR once the InbreedingCoefficient is updated.

PED files

The PED files used as input for these tools are based on PLINK pedigree files. The general description can be found here.

For these tools, the PED files must contain only the first 6 columns from the PLINK format PED file, and no alleles, like a FAM file in PLINK.

Comments (13)

Read-backed Phasing

Example and Command Line Arguments

For a complete, detailed argument reference, refer to the GATK document page here


The biological unit of inheritance from each parent in a diploid organism is a set of single chromosomes, so that a diploid organism contains a set of pairs of corresponding chromosomes. The full sequence of each inherited chromosome is also known as a haplotype. It is critical to ascertain which variants are associated with one another in a particular individual. For example, if an individual's DNA possesses two consecutive heterozygous sites in a protein-coding sequence, there are two alternative scenarios of how these variants interact and affect the phenotype of the individual. In one scenario, they are on two different chromosomes, so each one has its own separate effect. On the other hand, if they co-occur on the same chromosome, they are thus expressed in the same protein molecule; moreover, if they are within the same codon, they are highly likely to encode an amino acid that is non-synonymous (relative to the other chromosome). The ReadBackedPhasing program serves to discover these haplotypes based on high-throughput sequencing reads.

The first step in phasing is to call variants ("genotype calling") using a SAM/BAM file of reads aligned to the reference genome -- this results in a VCF file. Using the VCF file and the SAM/BAM reads file, the ReadBackedPhasing tool considers all reads within a Bayesian framework and attempts to find the local haplotype with the highest probability, based on the reads observed.

The local haplotype and its phasing is encoded in the VCF file as a "|" symbol (which indicates that the alleles of the genotype correspond to the same order as the alleles for the genotype at the preceding variant site). For example, the following VCF indicates that SAMP1 is heterozygous at chromosome 20 positions 332341 and 332503, and the reference base at the first position (A) is on the same chromosome of SAMP1 as the alternate base at the latter position on that chromosome (G), and vice versa (G with C):

chr20   332341  rs6076509   A   G   470.60  PASS    AB=0.46;AC=1;AF=0.50;AN=2;DB;DP=52;Dels=0.00;HRun=1;HaplotypeScore=0.98;MQ=59.11;MQ0=0;OQ=627.69;QD=12.07;SB=-145.57    GT:DP:GL:GQ 0/1:46:-79.92,-13.87,-84.22:99
chr20   332503  rs6133033   C   G   726.23  PASS    AB=0.57;AC=1;AF=0.50;AN=2;DB;DP=61;Dels=0.00;HRun=1;HaplotypeScore=0.95;MQ=60.00;MQ0=0;OQ=894.70;QD=14.67;SB=-472.75    GT:DP:GL:GQ:PQ  1|0:60:-110.83,-18.08,-149.73:99:126.93

The per-sample per-genotype PQ field is used to provide a Phred-scaled phasing quality score based on the statistical Bayesian framework employed for phasing. Note that for cases of homozygous sites that lie in between phased heterozygous sites, these homozygous sites will be phased with the same quality as the next heterozygous site.


  • ReadBackedPhasing doesn't currently support insertions, deletions, or multi-nucleotide polymorphisms.
  • Input VCF files should only be for diploid organisms.

More detailed aspects of semantics of phasing in the VCF format

  • The "|" symbol is used for each sample to indicate that each of the alleles of the genotype in question derive from the same haplotype as each of the alleles of the genotype of the same sample in the previous NON-FILTERED variant record. That is, rows without FILTER=PASS are essentially ignored in the read-backed phasing (RBP) algorithm.
  • Note that the first heterozygous genotype record in a pair of haplotypes will necessarily have a "/" - otherwise, they would be the continuation of the preceding haplotypes.
  • A homozygous genotype is always "appended" to the preceding haplotype. For example, any 0/0 or 1/1 record is always converted into 0|0 and 1|1.
  • RBP attempts to phase a heterozygous genotype relative the preceding HETEROZYGOUS genotype for that sample. If there is sufficient read information to deduce the two haplotypes (for that sample), then the current genotype is declared phased ("/" changed to "|") and assigned a PQ that is proportional to the estimated Phred-scaled error rate. All homozygous genotypes for that sample that lie in between the two heterozygous genotypes are also assigned the same PQ value (and remain phased).
  • If RBP cannot phase the heterozygous genotype, then the genotype remains with a "/", and no PQ score is assigned. This site essentially starts a new section of haplotype for this sample.

For example, consider the following records from the VCF file:

chr1    1   .   A   G   99  PASS    .   GT:GL:GQ    0/1:-100,0,-100:99  0/1:-100,0,-100:99
chr1    2   .   A   G   99  PASS    .   GT:GL:GQ:PQ 1|1:-100,0,-100:99:60   0|1:-100,0,-100:99:50
chr1    3   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:60   0|0:-100,0,-100:99:60
chr1    4   .   A   G   99  FAIL    .   GT:GL:GQ    0/1:-100,0,-100:99  0/1:-100,0,-100:99
chr1    5   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:70   1|0:-100,0,-100:99:60
chr1    6   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0/1:-100,0,-100:99  1|1:-100,0,-100:99:70
chr1    7   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:80   0|1:-100,0,-100:99:70
chr1    8   .   A   G   99  PASS    .   GT:GL:GQ:PQ 0|1:-100,0,-100:99:90   0|1:-100,0,-100:99:80

The proper interpretation of these records is that SAMP1 has the following haplotypes at positions 1-5 of chromosome 1:

  1. AGAAA
  2. GGGAG

And two haplotypes at positions 6-8:

  1. AAA
  2. GGG

And, SAMP2 has the two haplotypes at positions 1-8:

  • Note that we have excluded the non-PASS SNP call (at chr1:4), thus assuming that both samples are homozygous reference at that site.
Comments (25)

Note: As of version 4, BEAGLE reads and outputs VCF files directly, and can handle multiallelic sites. We have not yet evaluated what this means for the GATK-BEAGLE interface; it is possible that some of the information provided below is no longer applicable as a result.


BEAGLE is a state of the art software package for analysis of large-scale genetic data sets with hundreds of thousands of markers genotyped on thousands of samples. BEAGLE can

  • phase genotype data (i.e. infer haplotypes) for unrelated individuals, parent-offspring pairs, and parent-offspring trios.
  • infer sporadic missing genotype data.
  • impute ungenotyped markers that have been genotyped in a reference panel.
  • perform single marker and haplotypic association analysis.
  • detect genetic regions that are homozygous-by-descent in an individual or identical-by-descent in pairs of individuals.

The GATK provides an experimental interface to BEAGLE. Currently, the only use cases supported by this interface are a) inferring missing genotype data from call sets (e.g. for lack of coverage in low-pass data), b) Genotype inference for unrelated individuals.


The basic workflow for this interface is as follows:

After variants are called and possibly filtered, the GATK walker ProduceBeagleInput will take the resulting VCF as input, and will produce a likelihood file in BEAGLE format.

  • User needs to run BEAGLE with this likelihood file specified as input.
  • After Beagle runs, user must unzip resulting output files (.gprobs, .phased) containing posterior genotype probabilities and phased haplotypes.
  • User can then run GATK walker BeagleOutputToVCF to produce a new VCF with updated data. The new VCF will contain updated genotypes as well as updated annotations.

Producing Beagle input likelihoods file

Before running BEAGLE, we need to first take an input VCF file with genotype likelihoods and produce the BEAGLE likelihoods file using walker ProduceBealgeInput, as described in detail in its documentation page.

For each variant in inputvcf.vcf, ProduceBeagleInput will extract the genotype likelihoods, convert from log to linear space, and produce a BEAGLE input file in Genotype likelihoods file format (see BEAGLE documentation for more details). Essentially, this file is a text file in tabular format, a snippet of which is pasted below:

marker    alleleA alleleB NA07056 NA07056 NA07056 NA11892 NA11892 NA11892 
20:60251    T        C     10.00   1.26    0.00     9.77   2.45    0.00 
20:60321    G        T     10.00   5.01    0.01    10.00   0.31    0.00 
20:60467    G        C      9.55   2.40    0.00     9.55   1.20    0.00 

Note that BEAGLE only supports biallelic sites. Markers can have an arbitrary label, but they need to be in chromosomal order. Sites that are not genotyped in the input VCF (i.e. which are annotated with a "./." string and have no Genotype Likelihood annotation) are assigned a likelihood value of (0.33, 0.33, 0.33).

IMPORTANT: Due to BEAGLE memory restrictions, it's strongly recommended that BEAGLE be run on a separate chromosome-by-chromosome basis. In the current use case, BEAGLE uses RAM in a manner approximately proportional to the number of input markers. After BEAGLE is run and an output VCF is produced as described below, CombineVariants can be used to combine resulting VCF's, using the "-variantMergeOptions UNION" argument.

Running Beagle

We currently only support a subset of BEAGLE functionality - only unphased, unrelated input likelihood data is supported. To run imputation analysis, run for example

java -Xmx4000m -jar path_to_beagle/beagle.jar like=path_to_beagle_output/beagle_output out=myrun

Extra BEAGLE arguments can be added as required.

About Beagle memory usage

Empirically, Beagle can run up to about ~800,000 markers with 4 GB of RAM. Larger chromosomes require additional memory.

Processing BEAGLE output files

BEAGLE will produce several output files. The following shell commands unzip the output files in preparation for their being processed, and put them all in the same place:

# unzip gzip'd files, force overwrite if existing
gunzip -f path_to_beagle_output/myrun.beagle_output.gprobs.gz
gunzip -f path_to_beagle_output/myrun.beagle_output.phased.gz
#rename also Beagle likelihood file to mantain consistency
mv path_to_beagle_output/beagle_output path_to_beagle_output/ 

Creating a new VCF from BEAGLE data with BeagleOutputToVCF

Once BEAGLE files are produced, we can update our original VCF with BEAGLE's data. This is done using the BeagleOutputToVCF tool.

The walker looks for the files specified with the -B(type,BEAGLE,file) triplets as above for the output posterior genotype probabilities, the output r^2 values and the output phased genotypes. The order in which these are given in the command line is arbitrary, but all three must be present for correct operation.

The output VCF has the new genotypes that Beagle produced, and several annotations are also updated. By default, the walker will update the per-genotype annotations GQ (Genotype Quality), the genotypes themselves, as well as the per-site annotations AF (Allele Frequency), AC (Allele Count) and AN (Allele Number).

The resulting VCF can now be used for further downstream analysis.

Merging VCFs broken up by chromosome into a single genome-wide file

Assuming you have broken up your calls into Beagle by chromosome (as recommended above), you can use the CombineVariants tool to merge the resulting VCFs into a single callset.

java -jar /path/to/dist/GenomeAnalysisTK.jar \
  -T CombineVariants \
  -R reffile.fasta \
  --out genome_wide_output.vcf \
  -V:input1 beagle_output_chr1.vcf \
  -V:input2 beagle_output_chr2.vcf \
  -V:inputX beagle_output_chrX.vcf \
  -type UNION -priority input1,input2,...,inputX

Frequently Asked Questions

Comments (1)

1. What file formats do you support for interval lists?

We support three types of interval lists, as mentioned here. Interval lists should preferentially be formatted as Picard-style interval lists, with an explicit sequence dictionary, as this prevents accidental misuse (e.g. hg18 intervals on an hg19 file). Note that this file is 1-based, not 0-based (first position in the genome is position 1).

2. I have two (or more) sequencing experiments with different target intervals. How can I combine them?

One relatively easy way to combine your intervals is to use the online tool Galaxy, using the Get Data -> Upload command to upload your intervals, and the Operate on Genomic Intervals command to compute the intersection or union of your intervals (depending on your needs).

Comments (0)

1. What file formats do you support for variant callsets?

We support the Variant Call Format (VCF) for variant callsets. No other file formats are supported.

2. How can I know if my VCF file is valid?

VCFTools contains a validation tool that will allow you to verify it.

3. Are you planning to include any converters from different formats or allow different input formats than VCF?

No, we like VCF and we think it's important to have a good standard format. Multiplying formats just makes life hard for everyone, both developers and analysts.

Comments (77)

This document describes "regular" (variants-only) VCF files. For information on the gVCF format produced by HaplotypeCaller in -ERC GVCF mode, please see this companion document.

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence indicated by GQ = 25.92 isn't so good, largely because there were only a total of 4 reads at this site (DP =4), 1 of which was REF (=had the reference base) and 3 of which were ALT (=had the alternate base) (indicated by AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value that corresponds to a likelihood of 1.0). There's a chance that the subject is "hom-var" (=homozygous with the variant allele) since PL(1/1) = 26, which corresponds to 10^(-2.6), or 0.0025, but either way, it's clear that the subject is definitely not "hom-ref" (=homozygous with the reference allele) since PL(0/0) = 103, which corresponds to 10^(-10.3), a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Functional Annotation

It's all well and good to have a bunch of variant sites and genotypes, but how can you know whether they might be biologically relevant? That's where functional annotation comes in; this is the process of adding annotations to variant sites that tell you whether they fall within a coding or regulatory region, whether the mutation is sense or nonsense, etc. The GATK does not include any tool that perform functional annotation as such, but it does include conversion tools that allow you to interface with the popular annotation program SnpEff.


Comments (20)

IMPORTANT NOTE: This document is out of date and will be replaced soon. In the meantime, you can find accurate information on how to run SnpEff in a compatible way with GATK in the SnpEff documentation, and instructions on what steps are necessary in the presentation on Functional Annotation linked in the comments below.

Our testing has shown that not all combinations of snpEff/database versions produce high-quality results. Be sure to read this document completely to familiarize yourself with our recommended best practices BEFORE running snpEff.


Until recently we were using an in-house annotation tool for genomic annotation, but the burden of keeping the database current and our lack of ability to annotate indels has led us to employ the use of a third-party tool instead. After reviewing many external tools (including annoVar, VAT, and Oncotator), we decided that SnpEff best meets our needs as it accepts VCF files as input, can annotate a full exome callset (including indels) in seconds, and provides continually-updated transcript databases. We have implemented support in the GATK for parsing the output from the SnpEff tool and annotating VCFs with the information provided in it.

SnpEff Setup and Usage

Download the SnpEff core program. If you want to be able to run VariantAnnotator on the SnpEff output, you'll need to download a version of SnpEff that VariantAnnotator supports from this page (currently supported versions are listed below). If you just want the most recent version of SnpEff and don't plan to run VariantAnnotator on its output, you can get it from here.

After unzipping the core program, open the file snpEff.config in a text editor, and change the "database_repository" line to the following:

database_repository =

Then, download one or more databases using SnpEff's built-in download command:

java -jar snpEff.jar download GRCh37.64

You can find a list of available databases here. The human genome databases have GRCh or hg in their names. You can also download the databases directly from the SnpEff website, if you prefer.

The download command by default puts the databases into a subdirectory called data within the directory containing the SnpEff jar file. If you want the databases in a different directory, you'll need to edit the data_dir entry in the file snpEff.config to point to the correct directory.

Run SnpEff on the file containing your variants, and redirect its output to a file. SnpEff supports many input file formats including VCF 4.1, BED, and SAM pileup. Full details and command-line options can be found on the SnpEff home page.

Supported SnpEff Versions

If you want to take advantage of SnpEff integration in the GATK, you'll need to run SnpEff version **2.0.5*. Note: newer versions are currently unsupported by the GATK, as we haven't yet had the reources to test it.

Current Recommended Best Practices When Running SnpEff

These best practices are based on our analysis of various snpEff/database versions as described in detail in the Analysis of SnpEff Annotations Across Versions section below.

  • We recommend using only the GRCh37.64 database with SnpEff 2.0.5. The more recent GRCh37.65 database produces many false-positive Missense annotations due to a regression in the ENSEMBL Release 65 GTF file used to build the database. This regression has been acknowledged by ENSEMBL and is supposedly fixed as of 1-30-2012; however as we have not yet tested the fixed version of the database we continue to recommend using only GRCh37.64 for now.

  • We recommend always running with -onlyCoding true with human databases (eg., the GRCh37.* databases). Setting -onlyCoding false causes snpEff to report all transcripts as if they were coding (even if they're not), which can lead to nonsensical results. The -onlyCoding false option should only be used with databases that lack protein coding information.

  • Do not trust annotations from versions of snpEff prior to 2.0.4. Older versions of snpEff (such as 2.0.2) produced many incorrect annotations due to the presence of a certain number of nonsensical transcripts in the underlying ENSEMBL databases. Newer versions of snpEff filter out such transcripts.

Analyses of SnpEff Annotations Across Versions

See our analysis of the SNP annotations produced by snpEff across various snpEff/database versions here.

  • Both snpEff 2.0.2 + GRCh37.63 and snpEff 2.0.5 + GRCh37.65 produce an abnormally high Missense:Silent ratio, with elevated levels of Missense mutations across the entire spectrum of allele counts. They also have a relatively low (~70%) level of concordance with the 1000G Gencode annotations when it comes to Silent mutations. This suggests that these combinations of snpEff/database versions incorrectly annotate many Silent mutations as Missense.

  • snpEff 2.0.4 RC3 + GRCh37.64 and snpEff 2.0.5 + GRCh37.64 produce a Missense:Silent ratio in line with expectations, and have a very high (~97%-99%) level of concordance with the 1000G Gencode annotations across all categories.

See our comparison of SNP annotations produced using the GRCh37.64 and GRCh37.65 databases with snpEff 2.0.5 here

  • The GRCh37.64 database gives good results on the condition that you run snpEff with the -onlyCoding true option. The -onlyCoding false option causes snpEff to mark all transcripts as coding, and so produces many false-positive Missense annotations.

  • The GRCh37.65 database gives results that are as poor as those you get with the -onlyCoding false option on the GRCh37.64 database. This is due to a regression in the ENSEMBL release 65 GTF file used to build snpEff's GRCh37.65 database. The regression has been acknowledged by ENSEMBL and is due to be fixed shortly.

See our analysis of the INDEL annotations produced by snpEff across snpEff/database versions here

  • snpEff's indel annotations are highly concordant with those of a high-quality set of genomic annotations from the 1000 Genomes project. This is true across all snpEff/database versions tested.

Example SnpEff Usage with a VCF Input File

Below is an example of how to run SnpEff version 2.0.5 with a VCF input file and have it write its output in VCF format as well. Notice that you need to explicitly specify the database you want to use (in this case, GRCh37.64). This database must be present in a directory of the same name within the data_dir as defined in snpEff.config.

java -Xmx4G -jar snpEff.jar eff -v -onlyCoding true -i vcf -o vcf GRCh37.64 1000G.exomes.vcf > snpEff_output.vcf

In this mode, SnpEff aggregates all effects associated with each variant record together into a single INFO field annotation with the key EFF. The general format is:

EFF=Effect1(Information about Effect1),Effect2(Information about Effect2),etc.

And here is the precise layout with all the subfields:


It's also possible to get SnpEff to output in a (non-VCF) text format with one Effect per line. See the SnpEff home page for full details.

Adding SnpEff Annotations using VariantAnnotator

Once you have a SnpEff output VCF file, you can use the VariantAnnotator walker to add SnpEff annotations based on that output to the input file you ran SnpEff on.

There are two different options for doing this:

Option 1: Annotate with only the highest-impact effect for each variant

NOTE: This option works only with supported SnpEff versions as explained above. VariantAnnotator run as described below will refuse to parse SnpEff output files produced by other versions of the tool, or which lack a SnpEff version number in their header.

The default behavior when you run VariantAnnotator on a SnpEff output file is to parse the complete set of effects resulting from the current variant, select the most biologically-significant effect, and add annotations for just that effect to the INFO field of the VCF record for the current variant. This is the mode we plan to use in our Production Data-Processing Pipeline.

When selecting the most biologically-significant effect associated with the current variant, VariantAnnotator does the following:

  • Prioritizes the effects according to the categories (in order of decreasing precedence) "High-Impact", "Moderate-Impact", "Low-Impact", and "Modifier", and always selects one of the effects from the highest-priority category. For example, if there are three moderate-impact effects and two high-impact effects resulting from the current variant, the annotator will choose one of the high-impact effects and add annotations based on it. See below for a full list of the effects arranged by category.

  • Within each category, ties are broken using the functional class of each effect (in order of precedence: NONSENSE, MISSENSE, SILENT, or NONE). For example, if there is both a NON_SYNONYMOUS_CODING (MODERATE-impact, MISSENSE) and a CODON_CHANGE (MODERATE-impact, NONE) effect associated with the current variant, the annotator will select the NON_SYNONYMOUS_CODING effect. This is to allow for more accurate counts of the total number of sites with NONSENSE/MISSENSE/SILENT mutations. See below for a description of the functional classes SnpEff associates with the various effects.

  • Effects that are within a non-coding region are always considered lower-impact than effects that are within a coding region.

Example Usage:

java -jar dist/GenomeAnalysisTK.jar \
     -T VariantAnnotator \
     -R /humgen/1kg/reference/human_g1k_v37.fasta \
     -A SnpEff \       
     --variant 1000G.exomes.vcf \        (file to annotate)
     --snpEffFile snpEff_output.vcf \    (SnpEff VCF output file generated by running SnpEff on the file to annotate)
     -L 1000G.exomes.vcf \
     -o out.vcf

VariantAnnotator adds some or all of the following INFO field annotations to each variant record:

  • SNPEFF_EFFECT - The highest-impact effect resulting from the current variant (or one of the highest-impact effects, if there is a tie)
  • SNPEFF_IMPACT - Impact of the highest-impact effect resulting from the current variant (HIGH, MODERATE, LOW, or MODIFIER)
  • SNPEFF_FUNCTIONAL_CLASS - Functional class of the highest-impact effect resulting from the current variant (NONE, SILENT, MISSENSE, or NONSENSE)
  • SNPEFF_CODON_CHANGE - Old/New codon for the highest-impact effect resulting from the current variant
  • SNPEFF_AMINO_ACID_CHANGE - Old/New amino acid for the highest-impact effect resulting from the current variant
  • SNPEFF_GENE_NAME - Gene name for the highest-impact effect resulting from the current variant
  • SNPEFF_GENE_BIOTYPE - Gene biotype for the highest-impact effect resulting from the current variant
  • SNPEFF_TRANSCRIPT_ID - Transcript ID for the highest-impact effect resulting from the current variant
  • SNPEFF_EXON_ID - Exon ID for the highest-impact effect resulting from the current variant

Example VCF records annotated using SnpEff and VariantAnnotator:

1   874779  .   C   T   279.94  . AC=1;AF=0.0032;AN=310;BaseQRankSum=-1.800;DP=3371;Dels=0.00;FS=0.000;HRun=0;HaplotypeScore=1.4493;InbreedingCoeff=-0.0045;

1   874816  .   C   CT  2527.52 .   AC=15;AF=0.0484;AN=310;BaseQRankSum=-11.876;DP=4718;FS=48.575;HRun=1;HaplotypeScore=91.9147;InbreedingCoeff=-0.0520;

Option 2: Annotate with all effects for each variant

VariantAnnotator also has the ability to take the EFF field from the SnpEff VCF output file containing all the effects aggregated together and copy it verbatim into the VCF to annotate.

Here's an example of how to do this:

java -jar dist/GenomeAnalysisTK.jar \
     -T VariantAnnotator \
     -R /humgen/1kg/reference/human_g1k_v37.fasta \      
     -E resource.EFF \
     --variant 1000G.exomes.vcf \      (file to annotate)
     --resource snpEff_output.vcf \    (SnpEff VCF output file generated by running SnpEff on the file to annotate)
     -L 1000G.exomes.vcf \
     -o out.vcf

Of course, in this case you can also use the VCF output by SnpEff directly, but if you are using VariantAnnotator for other purposes anyway the above might be useful.

List of Genomic Effects

Below are the possible genomic effects recognized by SnpEff, grouped by biological impact. Full descriptions of each effect are available on this page.

High-Impact Effects


Moderate-Impact Effects

  • CODON_CHANGE (note: this effect is used by SnpEff only for MNPs, not SNPs)

Low-Impact Effects



  • NONE
  • CDS
  • GENE
  • EXON

Functional Classes

SnpEff assigns a functional class to certain effects, in addition to an impact:

  • NONSENSE: assigned to point mutations that result in the creation of a new stop codon
  • MISSENSE: assigned to point mutations that result in an amino acid change, but not a new stop codon
  • SILENT: assigned to point mutations that result in a codon change, but not an amino acid change or new stop codon
  • NONE: assigned to all effects that don't fall into any of the above categories (including all events larger than a point mutation)

The GATK prioritizes effects with functional classes over effects of equal impact that lack a functional class when selecting the most significant effect in VariantAnnotator. This is to enable accurate counts of NONSENSE/MISSENSE/SILENT sites.

Comments (5)

1. About the RefSeq Format

From the NCBI RefSeq website

The Reference Sequence (RefSeq) collection aims to provide a comprehensive, integrated, non-redundant, well-annotated set of sequences, including genomic DNA, transcripts, and proteins. RefSeq is a foundation for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis (especially RefSeqGene records), expression studies, and comparative analyses.

2. In the GATK

The GATK uses RefSeq in a variety of walkers, from indel calling to variant annotations. There are many file format flavors of ReqSeq; we've chosen to use the table dump available from the UCSC genome table browser.

3. Generating RefSeq files

Go to the UCSC genome table browser. There are many output options, here are the changes that you'll need to make:

clade:    Mammal
genome:   Human
assembly: ''choose the appropriate assembly for the reference you're using''
group:    Genes abd Gene Prediction Tracks
track:    RefSeq Genes
table:    refGene
region:   ''choose the genome option''

Choose a good output filename, something like geneTrack.refSeq, and click the get output button. You now have your initial RefSeq file, which will not be sorted, and will contain non-standard contigs. To run with the GATK, contigs other than the standard 1-22,X,Y,MT must be removed, and the file sorted in karyotypic order. This can be done with a combination of grep, sort, and a script called that is available here.

4. Running with the GATK

You can provide your RefSeq file to the GATK like you would for any other ROD command line argument. The line would look like the following:

-[arg]:REFSEQ /path/to/refSeq

Using the filename from above.


The GATK automatically adjusts the start and stop position of the records from zero-based half-open intervals (UCSC standard) to one-based closed intervals.

For example:

The first 19 bases in Chromsome one:
Chr1:0-19 (UCSC system)
Chr1:1-19 (GATK)

All of the GATK output is also in this format, so if you're using other tools or scripts to process RefSeq or GATK output files, you should be aware of this difference.

Frequently Asked Questions

Comments (0)

1. What file formats do you support for variant callsets?

We support the Variant Call Format (VCF) for variant callsets. No other file formats are supported.

2. How can I know if my VCF file is valid?

VCFTools contains a validation tool that will allow you to verify it.

3. Are you planning to include any converters from different formats or allow different input formats than VCF?

No, we like VCF and we think it's important to have a good standard format. Multiplying formats just makes life hard for everyone, both developers and analysts.

Comments (77)

This document describes "regular" (variants-only) VCF files. For information on the gVCF format produced by HaplotypeCaller in -ERC GVCF mode, please see this companion document.

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence indicated by GQ = 25.92 isn't so good, largely because there were only a total of 4 reads at this site (DP =4), 1 of which was REF (=had the reference base) and 3 of which were ALT (=had the alternate base) (indicated by AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value that corresponds to a likelihood of 1.0). There's a chance that the subject is "hom-var" (=homozygous with the variant allele) since PL(1/1) = 26, which corresponds to 10^(-2.6), or 0.0025, but either way, it's clear that the subject is definitely not "hom-ref" (=homozygous with the reference allele) since PL(0/0) = 103, which corresponds to 10^(-10.3), a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.

Variant Evaluation

Whether your callset is big or small, you'll probably need to evaluate it against others, or query it to identify the variants that are relevant to your work. The GATK offers multiple ways to perform these tasks efficiently at scale. For this step, we do not provide a standardized workflow because it depends too much on the needs of individual projects. However, our documentation provides a number of concrete examples of what you can do with these tools.


Comments (18)


SelectVariants is a GATK tool used to subset a VCF file by many arbitrary criteria listed in the command line options below. The output VCF wiil have the AN (number of alleles), AC (allele count), AF (allele frequency), and DP (depth of coverage) annotations updated as necessary to accurately reflect the file's new contents.

Select Variants operates on VCF files (ROD Tracks) provided in the command line using the GATK's built in --variant option. You can provide multiple tracks for Select Variants but at least one must be named 'variant' and this will be the file all your analysis will be based of. Other tracks can be named as you please. Options requiring a reference to a ROD track name will use the track name provided in the -B option to refer to the correct VCF file (e.g. --discordance / --concordance ). All other analysis will be done in the 'variant' track.

Often, a VCF containing many samples and/or variants will need to be subset in order to facilitate certain analyses (e.g. comparing and contrasting cases vs. controls; extracting variant or non-variant loci that meet certain requirements, displaying just a few samples in a browser like IGV, etc.). SelectVariants can be used for this purpose. Given a single VCF file, one or more samples can be extracted from the file (based on a complete sample name or a pattern match). Variants can be further selected by specifying criteria for inclusion, i.e. "DP > 1000" (depth of coverage greater than 1000x), "AF < 0.25" (sites with allele frequency less than 0.25). These JEXL expressions are documented here in the FAQ article on JEXL expressions; it is particularly important to note the section on working with complex expressions.

Command-line arguments

For a complete, detailed argument reference, refer to the GATK document page here.

How do the AC, AF, AN, and DP fields change?

Let's say you have a file with three samples. The numbers before the ":" will be the genotype (0/0 is hom-ref, 0/1 is het, and 1/1 is hom-var), and the number after will be the depth of coverage.

BOB        MARY        LINDA
1/0:20     0/0:30      1/1:50

In this case, the INFO field will say AN=6, AC=3, AF=0.5, and DP=100 (in practice, I think these numbers won't necessarily add up perfectly because of some read filters we apply when calling, but it's approximately right).

Now imagine I only want a file with the samples "BOB" and "MARY". The new file would look like:

BOB        MARY
1/0:20     0/0:30

The INFO field will now have to change to reflect the state of the new data. It will be AN=4, AC=1, AF=0.25, DP=50.

Let's pretend that MARY's genotype wasn't 0/0, but was instead "./." (no genotype could be ascertained). This would look like

BOB        MARY
1/0:20     ./.:.

with AN=2, AC=1, AF=0.5, and DP=20.

Subsetting by sample and ALT alleles

SelectVariants now keeps (r5832) the alt allele, even if a record is AC=0 after subsetting the site down to selected samples. For example, when selecting down to just sample NA12878 from the OMNI VCF in 1000G (1525 samples), the resulting VCF will look like:

1       82154   rs4477212       A       G       .       PASS    AC=0;AF=0.00;AN=2;CR=100.0;DP=0;GentrainScore=0.7826;HW=1.0     GT:GC   0/0:0.7205
1       534247  SNP1-524110     C       T       .       PASS    AC=0;AF=0.00;AN=2;CR=99.93414;DP=0;GentrainScore=0.7423;HW=1.0  GT:GC   0/0:0.6491
1       565286  SNP1-555149     C       T       .       PASS    AC=2;AF=1.00;AN=2;CR=98.8266;DP=0;GentrainScore=0.7029;HW=1.0   GT:GC   1/1:0.3471
1       569624  SNP1-559487     T       C       .       PASS    AC=2;AF=1.00;AN=2;CR=97.8022;DP=0;GentrainScore=0.8070;HW=1.0   GT:GC   1/1:0.3942

Although NA12878 is 0/0 at the first sites, ALT allele is preserved in the VCF record. This is the correct behavior, as reducing samples down shouldn't change the character of the site, only the AC in the subpopulation. This is related to the tricky issue of isPolymorphic() vs. isVariant().

  • isVariant => is there an ALT allele?

  • isPolymorphic => is some sample non-ref in the samples?

In part this is complicated as the semantics of sites-only VCFs, where ALT = . is used to mean not-polymorphic. Unfortunately, I just don't think there's a consistent convention right now, but it might be worth at some point to adopt a single approach to handling this.

For clarity, in previous versions of SelectVariants, the first two monomorphic sites lose the ALT allele, because NA12878 is hom-ref at this site, resulting in VCF that looks like:

1       82154   rs4477212       A       .       .       PASS    AC=0;AF=0.00;AN=2;CR=100.0;DP=0;GentrainScore=0.7826;HW=1.0     GT:GC   0/0:0.7205
1       534247  SNP1-524110     C       .       .       PASS    AC=0;AF=0.00;AN=2;CR=99.93414;DP=0;GentrainScore=0.7423;HW=1.0  GT:GC   0/0:0.6491
1       565286  SNP1-555149     C       T       .       PASS    AC=2;AF=1.00;AN=2;CR=98.8266;DP=0;GentrainScore=0.7029;HW=1.0   GT:GC   1/1:0.3471
1       569624  SNP1-559487     T       C       .       PASS    AC=2;AF=1.00;AN=2;CR=97.8022;DP=0;GentrainScore=0.8070;HW=1.0   GT:GC   1/1:0.3942

If you really want a VCF without monomorphic sites, use the option to drop monomorphic sites after subsetting.

Known issues

Some VCFs may have repeated header entries with the same key name, for instance:

##FILTER=ABFilter,&quot;AB &gt; 0.75&quot;
##FILTER=HRunFilter,&quot;HRun &gt; 3.0&quot;
##FILTER=QDFilter,&quot;QD &lt; 5.0&quot;

Here, the "UG_bam_file_used" and "source" header lines appear multiple times. When SelectVariants is run on such a file, the program will emit warnings that these repeated header lines are being discarded, resulting in only the first instance of such a line being written to the resulting VCF. This behavior is not ideal, but expected under the current architecture.

Additional information

For information on how to construct regular expressions for use with this tool, see the "Summary of regular-expression constructs" section here.

Comments (18)

1. About CombineVariants

This tool combines VCF records from different sources. Any (unique) name can be used to bind your rod data and any number of sources can be input. This tool currently supports two different combination types for each of variants (the first 8 fields of the VCF) and genotypes (the rest)

For a complete, detailed argument reference, refer to the GATK document page here.

2. Logic for merging records across VCFs

CombineVariants will include a record at every site in all of your input VCF files, and annotate which input ROD bindings the record is present, pass, or filtered in in the set attribute in the INFO field (see below). In effect, CombineVariants always produces a union of the input VCFs. However, any part of the Venn of the N merged VCFs can be exacted using JEXL expressions on the set attribute using SelectVariants. If you want to extract just the records in common between two VCFs, you would first CombineVariants the two files into a single VCF, and then run SelectVariants to extract the common records with -select 'set == "Intersection"', as worked out in the detailed example below.

3. Handling PASS/FAIL records at the same site in multiple input files

The -filteredRecordsMergeType argument determines how CombineVariants handles sites where a record is present in multiple VCFs, but it is filtered in some and unfiltered in others, as described in the Tech Doc page for the tool.

4. Understanding the set attribute

The set INFO field indicates which call set the variant was found in. It can take on a variety of values indicating the exact nature of the overlap between the call sets. Note that the values are generalized for multi-way combinations, but here we describe only the values for 2 call sets being combined.

  • set=Intersection : occurred in both call sets, not filtered out

  • set=NAME : occurred in the call set NAME only

  • set=NAME1-filteredInNAME : occurred in both call sets, but was not filtered in NAME1 but was filtered in NAME2

  • set=filteredInAll : occurred in both call sets, but was filtered out of both

For three or more call sets combinations, you can see records like NAME1-NAME2 indicating a variant occurred in both NAME1 and NAME2 but not all sets.

5. Changing the set key

You can use -setKey foo to change the set=XXX tag to foo=XXX in your output. Additionally, -setKey null stops the set tag=value pair from being emitted at all.

6. Minimal VCF output

Add the -minimalVCF argument to CombineVariants if you want to eliminate unnecessary information from the INFO field and genotypes. The only fields emitted will be GT:GQ for genotypes and the keySet for INFO

An even more extreme output format is -sites_only, a general engine capability, where the genotypes for all samples are completely stripped away from the output format. Enabling this option results in a significant performance speedup as well.

7. Combining Variant Calls with a minimum set of input sites

Add the -minN (or --minimumN) command, followed by an integer if you want to only output records present in at least N input files. Useful, for example in combining several data sets where we only want to keep sites present in for example at least 2 of them (in which case -minN 2 should be added to the command line).

8. Example: intersecting two VCFs

In the following example, we use CombineVariants and SelectVariants to obtain only the sites in common between the OMNI 2.5M and HapMap3 sites in the GSA bundle.

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T CombineVariants -R bundle/b37/human_g1k_v37.fasta -L 1:1-1,000,000 -V:omni bundle/b37/1000G_omni2.5.b37.sites.vcf -V:hm3 bundle/b37/hapmap_3.3.b37.sites.vcf -o union.vcf
java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T SelectVariants -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -L 1:1-1,000,000 -V:variant union.vcf -select 'set == "Intersection";' -o intersect.vcf

This results in two vcf files, which look like:

==> union.vcf <==
1       990839  SNP1-980702     C       T       .       PASS    AC=150;AF=0.05384;AN=2786;CR=100.0;GentrainScore=0.7267;HW=0.0027632264;set=Intersection
1       990882  SNP1-980745     C       T       .       PASS    CR=99.79873;GentrainScore=0.7403;HW=0.005225421;set=omni
1       990984  SNP1-980847     G       A       .       PASS    CR=99.76005;GentrainScore=0.8406;HW=0.26163524;set=omni
1       992265  SNP1-982128     C       T       .       PASS    CR=100.0;GentrainScore=0.7412;HW=0.0025895447;set=omni
1       992819  SNP1-982682     G       A       .       id50    CR=99.72961;GentrainScore=0.8505;HW=4.811053E-17;set=FilteredInAll
1       993987  SNP1-983850     T       C       .       PASS    CR=99.85935;GentrainScore=0.8336;HW=9.959717E-28;set=omni
1       994391  rs2488991       G       T       .       PASS    AC=1936;AF=0.69341;AN=2792;CR=99.89378;GentrainScore=0.7330;HW=1.1741E-41;set=filterInomni-hm3
1       996184  SNP1-986047     G       A       .       PASS    CR=99.932205;GentrainScore=0.8216;HW=3.8830226E-6;set=omni
1       998395  rs7526076       A       G       .       PASS    AC=2234;AF=0.80187;AN=2786;CR=100.0;GentrainScore=0.8758;HW=0.67373306;set=Intersection
1       999649  SNP1-989512     G       A       .       PASS    CR=99.93262;GentrainScore=0.7965;HW=4.9767335E-4;set=omni

==> intersect.vcf <==
1       950243  SNP1-940106     A       C       .       PASS    AC=826;AF=0.29993;AN=2754;CR=97.341675;GentrainScore=0.7311;HW=0.15148845;set=Intersection
1       957640  rs6657048       C       T       .       PASS    AC=127;AF=0.04552;AN=2790;CR=99.86667;GentrainScore=0.6806;HW=2.286109E-4;set=Intersection
1       959842  rs2710888       C       T       .       PASS    AC=654;AF=0.23559;AN=2776;CR=99.849;GentrainScore=0.8072;HW=0.17526293;set=Intersection
1       977780  rs2710875       C       T       .       PASS    AC=1989;AF=0.71341;AN=2788;CR=99.89077;GentrainScore=0.7875;HW=2.9912625E-32;set=Intersection
1       985900  SNP1-975763     C       T       .       PASS    AC=182;AF=0.06528;AN=2788;CR=99.79926;GentrainScore=0.8374;HW=0.017794203;set=Intersection
1       987200  SNP1-977063     C       T       .       PASS    AC=1956;AF=0.70007;AN=2794;CR=99.45917;GentrainScore=0.7914;HW=1.413E-42;set=Intersection
1       987670  SNP1-977533     T       G       .       PASS    AC=2485;AF=0.89196;AN=2786;CR=99.51427;GentrainScore=0.7005;HW=0.24214932;set=Intersection
1       990417  rs2465136       T       C       .       PASS    AC=1113;AF=0.40007;AN=2782;CR=99.7599;GentrainScore=0.8750;HW=8.595538E-5;set=Intersection
1       990839  SNP1-980702     C       T       .       PASS    AC=150;AF=0.05384;AN=2786;CR=100.0;GentrainScore=0.7267;HW=0.0027632264;set=Intersection
1       998395  rs7526076       A       G       .       PASS    AC=2234;AF=0.80187;AN=2786;CR=100.0;GentrainScore=0.8758;HW=0.67373306;set=Intersection
Comments (25)

For a complete, detailed argument reference, refer to the technical documentation page.


You can find detailed information about the various modules here.

Stratification modules

  • AlleleFrequency
  • AlleleCount
  • CompRod
  • Contig
  • CpG
  • Degeneracy
  • EvalRod
  • Filter
  • FunctionalClass
  • JexlExpression
  • Novelty
  • Sample

Evaluation modules

  • CompOverlap
  • CountVariants

Note that the GenotypeConcordance module has been rewritten as a separate walker tool (see its Technical Documentation page).

A useful analysis using VariantEval

We in GSA often find ourselves performing an analysis of 2 different call sets. For SNPs, we often show the overlap of the sets (their "venn") and the relative dbSNP rates and/or transition-transversion ratios. The picture provided is an example of such a slide and is easy to create using VariantEval. Assuming you have 2 filtered VCF callsets named 'foo.vcf' and 'bar.vcf', there are 2 quick steps.

Combine the VCFs

java -jar GenomeAnalysisTK.jar \
    -R ref.fasta \
    -T CombineVariants \
    -V:FOO foo.vcf \
    -V:BAR bar.vcf \
    -priority FOO,BAR \
    -o merged.vcf

Run VariantEval

java -jar GenomeAnalysisTK.jar \
     -T VariantEval \
     -R ref.fasta \
     -D dbsnp.vcf \
     -select 'set=="Intersection"' -selectName Intersection \
     -select 'set=="FOO"' -selectName FOO \
     -select 'set=="FOO-filterInBAR"' -selectName InFOO-FilteredInBAR \
     -select 'set=="BAR"' -selectName BAR \
     -select 'set=="filterInFOO-BAR"' -selectName InBAR-FilteredInFOO \
     -select 'set=="FilteredInAll"' -selectName FilteredInAll \
     -o merged.eval.gatkreport \
     -eval merged.vcf \
     -l INFO

Checking the possible values of 'set'

It is wise to check the actual values for the set names present in your file before writing complex VariantEval commands. An easy way to do this is to extract the value of the set fields and then reduce that to the unique entries, like so:

java -jar GenomeAnalysisTK.jar -T VariantsToTable -R ref.fasta -V merged.vcf -F set -o fields.txt
grep -v 'set' fields.txt | sort | uniq -c

This will provide you with a list of all of the possible values for 'set' in your VCF so that you can be sure to supply the correct select statements to VariantEval.

Reading the VariantEval output file

The VariantEval output is formatted as a GATKReport.

Understanding Genotype Concordance values from Variant Eval

The VariantEval genotype concordance module emits information the relationship between the eval calls and genotypes and the comp calls and genotypes. The following three slides provide some insight into three key metrics to assess call sensitivity and concordance between genotypes.

##:GATKReport.v0.1 GenotypeConcordance.sampleSummaryStats&#160;: the concordance statistics summary for each sample
GenotypeConcordance.sampleSummaryStats  CompRod   CpG      EvalRod  JexlExpression  Novelty  percent_comp_ref_called_var  percent_comp_het_called_het  percent_comp_het_called_var  percent_comp_hom_called_hom  percent_comp_hom_called_var  percent_non-reference_sensitivity  percent_overall_genotype_concordance  percent_non-reference_discrepancy_rate
GenotypeConcordance.sampleSummaryStats  compOMNI  all      eval     none            all      0.78                         97.65                        98.39                        99.13                        99.44                        98.80                              99.09                                 3.60

The key outputs:

  • percent_overall_genotype_concordance
  • percent_non_ref_sensitivity_rate
  • percent_non_ref_discrepancy_rate

All defined below.

Frequently Asked Questions

Comments (0)

1. What file formats do you support for variant callsets?

We support the Variant Call Format (VCF) for variant callsets. No other file formats are supported.

2. How can I know if my VCF file is valid?

VCFTools contains a validation tool that will allow you to verify it.

3. Are you planning to include any converters from different formats or allow different input formats than VCF?

No, we like VCF and we think it's important to have a good standard format. Multiplying formats just makes life hard for everyone, both developers and analysts.

Comments (77)

This document describes "regular" (variants-only) VCF files. For information on the gVCF format produced by HaplotypeCaller in -ERC GVCF mode, please see this companion document.

1. What is VCF?

VCF stands for Variant Call Format. It is a standardized text file format for representing SNP, indel, and structural variation calls. See this page for detailed specifications.

VCF is the primary (and only well-supported) format used by the GATK for variant calls. We prefer it above all others because while it can be a bit verbose, the VCF format is very explicit about the exact type and sequence of variation as well as the genotypes of multiple samples for this variation.

That being said, this highly detailed information can be challenging to understand. The information provided by the GATK tools that infer variation from NGS data, such as the UnifiedGenotyper and the HaplotypeCaller, is especially complex. This document describes some specific features and annotations used in the VCF files output by the GATK tools.

2. Basic structure of a VCF file

The following text is a valid VCF file describing the first few SNPs found by the UG in a deep whole genome data set from our favorite test sample, NA12878:

##FILTER=<ID=LowQual,Description="QUAL < 50.0">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=PL,Number=3,Type=Float,Description="Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; not applicable if site is not biallelic">
##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with two (and only two) segregating haplotypes">
##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
##INFO=<ID=SB,Number=1,Type=Float,Description="Strand Bias">
##INFO=<ID=VQSLOD,Number=1,Type=Float,Description="log10-scaled probability of variant being true under the trained gaussian mixture model">
##UnifiedGenotyperV2="analysis_type=UnifiedGenotyperV2 input_file=[TEXT CLIPPED FOR CLARITY]"
chr1    873762  .       T   G   5231.78 PASS    AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473 GT:AD:DP:GQ:PL   0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185 GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148 GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual AC=1;AF=0.50;AN=2;DB;DP=18;Dels=0.00;HRun=1;HaplotypeScore=0.16;MQ=95.26;MQ0=0;QD=1.66;SB=-0.98 GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

It seems a bit complex, but the structure of the file is actually quite simple:

#CHROM  POS ID      REF ALT QUAL    FILTER  INFO          FORMAT          NA12878
chr1    873762  .       T   G   5231.78 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   3931.66 PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   71.77   PASS    [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:1,3:4:25.92:103,0,26
chr1    974165  rs9442391   T   C   29.84   LowQual [ANNOTATIONS] GT:AD:DP:GQ:PL  0/1:14,4:14:60.91:61,0,255

After the header lines and the field names, each line represents a single variant, with various properties of that variant represented in the columns. Note that here everything is a SNP, but some could be indels or CNVs.

3. How variation is represented

The first 6 columns of the VCF, which represent the observed variation, are easy to understand because they have a single, well-defined meaning.

  • CHROM and POS : The CHROM and POS gives the contig on which the variant occurs. For indels this is actually the base preceding the event, due to how indels are represented in a VCF.

  • ID: The dbSNP rs identifier of the SNP, based on the contig and position of the call and whether a record exists at this site in dbSNP.

  • REF and ALT: The reference base and alternative base that vary in the samples, or in the population in general. Note that REF and ALT are always given on the forward strand. For indels the REF and ALT bases always include at least one base each (the base before the event).

  • QUAL: The Phred scaled probability that a REF/ALT polymorphism exists at this site given sequencing data. Because the Phred scale is -10 * log(1-p), a value of 10 indicates a 1 in 10 chance of error, while a 100 indicates a 1 in 10^10 chance. These values can grow very large when a large amount of NGS data is used for variant calling.

  • FILTER: In a perfect world, the QUAL field would be based on a complete model for all error modes present in the data used to call. Unfortunately, we are still far from this ideal, and we have to use orthogonal approaches to determine which called sites, independent of QUAL, are machine errors and which are real SNPs. Whatever approach is used to filter the SNPs, the VCFs produced by the GATK carry both the PASSing filter records (the ones that are good have PASS in their FILTER field) as well as those that fail (the filter field is anything but PASS or a dot). If the FILTER field is a ".", then no filtering has been applied to the records, meaning that all of the records will be used for analysis but without explicitly saying that any PASS. You should avoid such a situation by always filtering raw variant calls before analysis.

For more details about these fields, please see this page.

In the excerpt shown above, here is how we interpret the line corresponding to each variant:

  • chr1:873762 is a novel T/G polymorphism, found with very high confidence (QUAL = 5231.78)
  • chr1:877664 is a known A/G SNP (named rs3828047), found with very high confidence (QUAL = 3931.66)
  • chr1:899282 is a known C/T SNP (named rs28548431), but has a relative low confidence (QUAL = 71.77)
  • chr1:974165 is a known T/C SNP but we have so little evidence for this variant in our data that although we write out a record for it (for book keeping, really) our statistical evidence is so low that we filter the record out as a bad site, as indicated by the "LowQual" annotation.

4. How genotypes are represented

The genotype fields of the VCF look more complicated but they're actually not that hard to interpret once you understand that they're just sets of tags and values. Let's take a look at three of the records shown earlier, simplified to just show the key genotype annotations:

chr1    873762  .       T   G   [CLIPPED] GT:AD:DP:GQ:PL    0/1:173,141:282:99:255,0,255
chr1    877664  rs3828047   A   G   [CLIPPED] GT:AD:DP:GQ:PL    1/1:0,105:94:99:255,255,0
chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

Looking at that last column, here is what the tags mean:

  • GT : The genotype of this sample. For a diploid organism, the GT field indicates the two alleles carried by the sample, encoded by a 0 for the REF allele, 1 for the first ALT allele, 2 for the second ALT allele, etc. When there's a single ALT allele (by far the more common case), GT will be either:

    • 0/0 - the sample is homozygous reference
    • 0/1 - the sample is heterozygous, carrying 1 copy of each of the REF and ALT alleles
    • 1/1 - the sample is homozygous alternate In the three examples above, NA12878 is observed with the allele combinations T/G, G/G, and C/T respectively.
  • GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT. In the diploid case, if GT is 0/1, then GQ is really L(0/1) / (L(0/0) + L(0/1) + L(1/1)), where L is the likelihood that the sample is 0/0, 0/1/, or 1/1 under the model built for the NGS dataset.

  • AD and DP: These are complementary fields that represent two important ways of thinking about the depth of the data for this sample at this site. See the Technical Documentation for details on AD (DepthPerAlleleBySample) and DP (Coverage).

  • PL: This field provides the likelihoods of the given genotypes (here, 0/0, 0/1, and 1/1). These are normalized, Phred-scaled likelihoods for each of the 0/0, 0/1, and 1/1, without priors. To be concrete, for the heterozygous case, this is L(data given that the true genotype is 0/1). The most likely genotype (given in the GT field) is scaled so that it's P = 1.0 (0 when Phred-scaled), and the other likelihoods reflect their Phred-scaled likelihoods relative to this most likely genotype.

With that out of the way, let's interpret the genotypes for NA12878 at chr1:899282.

chr1    899282  rs28548431  C   T   [CLIPPED] GT:AD:DP:GQ:PL    0/1:1,3:4:25.92:103,0,26

At this site, the called genotype is GT = 0/1, which is C/T. The confidence indicated by GQ = 25.92 isn't so good, largely because there were only a total of 4 reads at this site (DP =4), 1 of which was REF (=had the reference base) and 3 of which were ALT (=had the alternate base) (indicated by AD=1,3). The lack of certainty is evident in the PL field, where PL(0/1) = 0 (the normalized value that corresponds to a likelihood of 1.0). There's a chance that the subject is "hom-var" (=homozygous with the variant allele) since PL(1/1) = 26, which corresponds to 10^(-2.6), or 0.0025, but either way, it's clear that the subject is definitely not "hom-ref" (=homozygous with the reference allele) since PL(0/0) = 103, which corresponds to 10^(-10.3), a very small number.

5. Understanding annotations

Finally, variants in a VCF can be annotated with a variety of additional tags, either by the built-in tools or with others that you add yourself. The way they're formatted is similar to what we saw in the Genotype fields, except instead of being in two separate fields (tags and values, respectively) the annotation tags and values are grouped together, so tag-value pairs are written one after another.

chr1    873762  [CLIPPED] AC=1;AF=0.50;AN=2;DP=315;Dels=0.00;HRun=2;HaplotypeScore=15.11;MQ=91.05;MQ0=15;QD=16.61;SB=-1533.02;VQSLOD=-1.5473
chr1    877664  [CLIPPED] AC=2;AF=1.00;AN=2;DB;DP=105;Dels=0.00;HRun=1;HaplotypeScore=1.59;MQ=92.52;MQ0=4;QD=37.44;SB=-1152.13;VQSLOD= 0.1185
chr1    899282  [CLIPPED] AC=1;AF=0.50;AN=2;DB;DP=4;Dels=0.00;HRun=0;HaplotypeScore=0.00;MQ=99.00;MQ0=0;QD=17.94;SB=-46.55;VQSLOD=-1.9148

Here are some commonly used built-in annotations and what they mean:

Annotation tag in VCF Meaning
AC,AF,AN See the Technical Documentation for Chromosome Counts.
DB If present, then the variant is in dbSNP.
DP See the Technical Documentation for Coverage.
DS Were any of the samples downsampled because of too much coverage?
Dels See the Technical Documentation for SpanningDeletions.
MQ and MQ0 See the Technical Documentation for RMS Mapping Quality and Mapping Quality Zero.
BaseQualityRankSumTest See the Technical Documentation for Base Quality Rank Sum Test.
MappingQualityRankSumTest See the Technical Documentation for Mapping Quality Rank Sum Test.
ReadPosRankSumTest See the Technical Documentation for Read Position Rank Sum Test.
HRun See the Technical Documentation for Homopolymer Run.
HaplotypeScore See the Technical Documentation for Haplotype Score.
QD See the Technical Documentation for Qual By Depth.
VQSLOD Only present when using Variant quality score recalibration. Log odds ratio of being a true variant versus being false under the trained gaussian mixture model.
FS See the Technical Documentation for Fisher Strand
SB How much evidence is there for Strand Bias (the variation being seen on only the forward or only the reverse strand) in the reads? Higher SB values denote more bias (and therefore are more likely to indicate false positive calls).
Comments (22)

1. Notes on known sites

Why are they important?

Each tool uses known sites differently, but what is common to all is that they use them to help distinguish true variants from false positives, which is very important to how these tools work. If you don't provide known sites, the statistical analysis of the data will be skewed, which can dramatically affect the sensitivity and reliability of the results.

In the variant calling pipeline, the only tools that do not strictly require known sites are UnifiedGenotyper and HaplotypeCaller.

Human genomes

If you're working on human genomes, you're in luck. We provide sets of known sites in the human genome as part of our resource bundle, and we can give you specific Best Practices recommendations on which sets to use for each tool in the variant calling pipeline. See the next section for details.

Non-human genomes

If you're working on genomes of other organisms, things may be a little harder -- but don't panic, we'll try to help as much as we can. We've started a community discussion in the forum on What are the standard resources for non-human genomes? in which we hope people with non-human genomics experience will share their knowledge.

And if it turns out that there is as yet no suitable set of known sites for your organisms, here's how to make your own for the purposes of BaseRecalibration: First, do an initial round of SNP calling on your original, unrecalibrated data. Then take the SNPs that you have the highest confidence in and use that set as the database of known SNPs by feeding it as a VCF file to the base quality score recalibrator. Finally, do a real round of SNP calling with the recalibrated data. These steps could be repeated several times until convergence. Good luck!

Some experimentation will be required to figure out the best way to find the highest confidence SNPs for use here. Perhaps one could call variants with several different calling algorithms and take the set intersection. Or perhaps one could do a very strict round of filtering and take only those variants which pass the test.

2. Recommended sets of known sites per tool

Summary table

Tool dbSNP 129 - - dbSNP >132 - - Mills indels - - 1KG indels - - HapMap - - Omni
RealignerTargetCreator X X
IndelRealigner X X
BaseRecalibrator X X X
(UnifiedGenotyper/ HaplotypeCaller) X
VariantRecalibrator X X X X
VariantEval X

RealignerTargetCreator and IndelRealigner

These tools require known indels passed with the -known argument to function properly. We use both the following files:

  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)


This tool requires known SNPs and indels passed with the -knownSites argument to function properly. We use all the following files:

  • The most recent dbSNP release (build ID > 132)
  • Mills_and_1000G_gold_standard.indels.b37.sites.vcf
  • 1000G_phase1.indels.b37.vcf (currently from the 1000 Genomes Phase I indel calls)

UnifiedGenotyper / HaplotypeCaller

These tools do NOT require known sites, but if SNPs are provided with the -dbsnp argument they will use them for variant annotation. We use this file:

  • The most recent dbSNP release (build ID > 132)


For VariantRecalibrator, please see the FAQ article on VQSR training sets and arguments.


This tool requires known SNPs passed with the -dbsnp argument to function properly. We use the following file:

  • A version of dbSNP subsetted to only sites discovered in or before dbSNP BuildID 129, which excludes the impact of the 1000 Genomes project and is useful for evaluation of dbSNP rate and Ti/Tv values at novel sites.
Comments (4)

VariantEval accepts two types of modules: stratification and evaluation modules.

  • Stratification modules will stratify (group) the variants based on certain properties.
  • Evaluation modules will compute certain metrics for the variants


CpG is a three-state stratification:

  • The locus is a CpG site ("CpG")
  • The locus is not a CpG site ("non_CpG")
  • The locus is either a CpG or not a CpG site ("all")

A CpG site is defined as a site where the reference base at a locus is a C and the adjacent reference base in the 3' direction is a G.


EvalRod is an N-state stratification, where N is the number of eval rods bound to VariantEval.


Sample is an N-state stratification, where N is the number of samples in the eval files.


Filter is a three-state stratification:

  • The locus passes QC filters ("called")
  • The locus fails QC filters ("filtered")
  • The locus either passes or fails QC filters ("raw")


FunctionalClass is a four-state stratification:

  • The locus is a synonymous site ("silent")
  • The locus is a missense site ("missense")
  • The locus is a nonsense site ("nonsense")
  • The locus is of any functional class ("any")


CompRod is an N-state stratification, where N is the number of comp tracks bound to VariantEval.


Degeneracy is a six-state stratification:

  • The underlying base position in the codon is 1-fold degenerate ("1-fold")
  • The underlying base position in the codon is 2-fold degenerate ("2-fold")
  • The underlying base position in the codon is 3-fold degenerate ("3-fold")
  • The underlying base position in the codon is 4-fold degenerate ("4-fold")
  • The underlying base position in the codon is 6-fold degenerate ("6-fold")
  • The underlying base position in the codon is degenerate at any level ("all")

See the [ Wikipedia page on degeneracy] for more information.


JexlExpression is an N-state stratification, where N is the number of JEXL expressions supplied to VariantEval. See [[Using JEXL expressions]]


Novelty is a three-state stratification:

  • The locus overlaps the knowns comp track (usually the dbSNP track) ("known")
  • The locus does not overlap the knowns comp track ("novel")
  • The locus either overlaps or does not overlap the knowns comp track ("all")


CountVariants is an evaluation module that computes the following metrics:

Metric Definition
nProcessedLoci Number of processed loci
nCalledLoci Number of called loci
nRefLoci Number of reference loci
nVariantLoci Number of variant loci
variantRate Variants per loci rate
variantRatePerBp Number of variants per base
nSNPs Number of snp loci
nInsertions Number of insertion
nDeletions Number of deletions
nComplex Number of complex loci
nNoCalls Number of no calls loci
nHets Number of het loci
nHomRef Number of hom ref loci
nHomVar Number of hom var loci
nSingletons Number of singletons
heterozygosity heterozygosity per locus rate
heterozygosityPerBp heterozygosity per base pair
hetHomRatio heterozygosity to homozygosity ratio
indelRate indel rate (insertion count + deletion count)
indelRatePerBp indel rate per base pair
deletionInsertionRatio deletion to insertion ratio


CompOverlap is an evaluation module that computes the following metrics:

Metric Definition
nEvalSNPs number of eval SNP sites
nCompSNPs number of comp SNP sites
novelSites number of eval sites outside of comp sites
nVariantsAtComp number of eval sites at comp sites (that is, sharing the same locus as a variant in the comp track, regardless of whether the alternate allele is the same)
compRate percentage of eval sites at comp sites
nConcordant number of concordant sites (that is, for the sites that share the same locus as a variant in the comp track, those that have the same alternate allele)
concordantRate the concordance rate

Understanding the output of CompOverlap

A SNP in the detection set is said to be 'concordant' if the position exactly matches an entry in dbSNP and the allele is the same. To understand this and other output of CompOverlap, we shall examine a detailed example. First, consider a fake dbSNP file (headers are suppressed so that one can see the important things):

 $ grep -v '##' dbsnp.vcf
 #CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO
 1       10327   rs112750067     T       C       .       .       ASP;R5;VC=SNP;VP=050000020005000000000100;WGT=1;dbSNPBuildID=132

Now, a detection set file with a single sample, where the variant allele is the same as listed in dbSNP:

 $ grep -v '##' eval_correct_allele.vcf
 #CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT            001-6
 1       10327   .       T       C       5168.52 PASS    ...     GT:AD:DP:GQ:PL    0/1:357,238:373:99:3959,0,4059

Finally, a detection set file with a single sample, but the alternate allele differs from that in dbSNP:

 $ grep -v '##' eval_incorrect_allele.vcf
 #CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT            001-6
 1       10327   .       T       A       5168.52 PASS    ...     GT:AD:DP:GQ:PL    0/1:357,238:373:99:3959,0,4059

Running VariantEval with just the CompOverlap module:

 $ java -jar $STING_DIR/dist/GenomeAnalysisTK.jar -T VariantEval \
        -R /seq/references/Homo_sapiens_assembly19/v1/Homo_sapiens_assembly19.fasta \
        -L 1:10327 \
        -B:dbsnp,VCF dbsnp.vcf \
        -B:eval_correct_allele,VCF eval_correct_allele.vcf \
        -B:eval_incorrect_allele,VCF eval_incorrect_allele.vcf \
        -noEV \
        -EV CompOverlap \
        -o eval.table

We find that the eval.table file contains the following:

 $ grep -v '##' eval.table | column -t 
 CompOverlap  CompRod  EvalRod                JexlExpression  Novelty  nEvalVariants  nCompVariants  novelSites  nVariantsAtComp  compRate      nConcordant  concordantRate
 CompOverlap  dbsnp    eval_correct_allele    none            all      1              1              0           1                100.00000000  1            100.00000000
 CompOverlap  dbsnp    eval_correct_allele    none            known    1              1              0           1                100.00000000  1            100.00000000
 CompOverlap  dbsnp    eval_correct_allele    none            novel    0              0              0           0                0.00000000    0            0.00000000
 CompOverlap  dbsnp    eval_incorrect_allele  none            all      1              1              0           1                100.00000000  0            0.00000000
 CompOverlap  dbsnp    eval_incorrect_allele  none            known    1              1              0           1                100.00000000  0            0.00000000
 CompOverlap  dbsnp    eval_incorrect_allele  none            novel    0              0              0           0                0.00000000    0            0.00000000

As you can see, the detection set variant was listed under nVariantsAtComp (meaning the variant was seen at a position listed in dbSNP), but only the eval_correct_allele dataset is shown to be concordant at that site, because the allele listed in this dataset and dbSNP match.


TiTvVariantEvaluator is an evaluation module that computes the following metrics:

Metric Definition
nTi number of transition loci
nTv number of transversion loci
tiTvRatio the transition to transversion ratio
nTiInComp number of comp transition sites
nTvInComp number of comp transversion sites
TiTvRatioStandard the transition to transversion ratio for comp sites

Do you have a question on this topic that wasn't addressed anywhere here? Please ask it here in the forum.