HaplotypeCaller Error: Mismatch between the reference haplotype and reference assembly graph path
Posted in Ask the GATK team | Last updated on

Comments (7)

Hi I have been running HaplotypeCaller on >700 monkey alignments and came across this error in some intervals:

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
java.lang.IllegalStateException: Mismatch between the reference haplotype and the reference assembly graph path. for graph BaseGraph{kmerSize=10} graph = GGAATAACTCCAGGCAACCA
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.LocalAssemblyEngine.sanityCheckReferenceGraph(LocalAssemblyEngine.java:396)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.LocalAssemblyEngine.sanityCheckGraph(LocalAssemblyEngine.java:378)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.LocalAssemblyEngine.runLocalAssembly(LocalAssemblyEngine.java:135)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.assembleReads(HaplotypeCaller.java:751)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:672)
        at org.broadinstitute.sting.gatk.walkers.haplotypecaller.HaplotypeCaller.map(HaplotypeCaller.java:136)
        at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions$TraverseActiveRegionMap.apply(TraverseActiveRegions.java:665)
        at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions$TraverseActiveRegionMap.apply(TraverseActiveRegions.java:661)
        at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.executeSingleThreaded(NanoScheduler.java:274)
        at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.execute(NanoScheduler.java:245)
        at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse(TraverseActiveRegions.java:260)
        at org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions.traverse(TraverseActiveRegions.java:80)
        at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:100)
        at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:301)
        at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
        at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
        at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
        at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:91)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version nightly-2013-05-17-g2c8b717):
##### ERROR
##### ERROR Please check the documentation guide to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our website and forum for extensive documentation and answers to 
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR ------------------------------------------------------------------------------------------

My commandline looks like (omitting long list of bam files):

java -Xms6000m -Xmx8000m -XX:PermSize=1500m -XX:MaxPermSize=2000m -jar gatk2Jar/GenomeAnalysisTK.jar --reference_sequence reference/3280_vervet_ref_6.0.3.fasta -T HaplotypeCaller --unsafe --validation_strictness SILENT --read_filter BadCigar --num_threads 1 -L:bed folder/Scaffold84_line_1064463_1069462_bed.tsv --out NewCaller/Scaffold84_1064463_1069462.orig.vcf --heterozygosity 0.01 --minPruning 2 --downsample_to_coverage 40 --downsampling_type BY_SAMPLE -I ...

Return to top Comment on this article in the forum