Different annotations for same co-ordinates in vcf
Posted in Ask the GATK team | Last updated on 2013-01-07 19:16:48


Comments (3)

Please look at lines 1 and 2 taken from a vcf file, which have same Chromosome and Position and one of the Alt allele is same in both lines, different allele count and have different rsID.

1 1229111 rs70949568 A ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC,C 2629.32 TruthSensitivityTranche99.50to99.90;TruthSensitivityTranche99.30to99.50 AC=80,31;AF=0.1273;AN=284;BaseQRankSum=1.124;DB;DP=426;Dels=0.00;FS=4.620;HRun=1;HaplotypeScore=0.2101;InbreedingCoeff=-0.0029;MQ0=0;MQ=58.46;MQRankSum=1.211;QD=5.26;ReadPosRankSum=-5.748;SB=-36.94;SF=0f,1f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-2.3894;culprit=MQ GT:DP:GQ:AD:PL

1 1229111 . A C 89.94 TruthSensitivityTranche99.00to99.30 AC=7;AF=0.0614;AN=114;BaseQRankSum=0.801;DP=175;Dels=0.00;FS=1.668;HRun=1;HaplotypeScore=0.2276;InbreedingCoeff=-0.0538;MQ0=0;MQ=57.90;MQRankSum=0.501;QD=4.28;ReadPosRankSum=-4.531;SB=-15.19;SF=0f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-1.4433;culprit=MQ GT:DP:GQ:AD:PL


Return to top Comment on this article in the forum