A: During the course of this project it has been our policy to release preliminary data as it was produced, along with the best maps we could construct in a short amount of time. For the May 1999 data release, we have cleaned up the maps following a stringent procedure described in Nusbaum, et al. (Nature Genetics 22(4):388-393).
As in every new data release, contig names may have changed as old contigs were merged together to form new ones. In addition, in this release some contigs have been broken apart because the data linking them together did not meet our new, stringent reliability standards. We have also refined the procedure for assigning random markers to chromosomes; random markers that were doubly-linked to genetic markers on more than one chromosome were not assigned anywhere. Thus, some markers may appear to have been removed from the physical map (though their data should still be in the database), and a few may even have been mapped on different chromosomes than they were on in earlier versions. In these cases, we believe the new maps to be more accurate than the older ones.
Q: What is the origin of the markers?
A: The names of our mapped markers indicate their origins. Markers were developed from three sources:
1) Random sequence. We mapped about 2700 STSs made from the sequence of random clones. These markers are named with the letter M, a hyphen, and a 5-digit number (e.g., M-01723). They were previously known by longer names ending in ".seq," such as 31.MMHAP26FRC10.seq and 28.MHAa62T.seq; these names still exist as marker aliases and can be used in database searches.2) Genes. We derived 700 markers from the 3' ends of CDSs in Genbank. These markers are denoted by their Genbank accession number on our maps (ex: X91864).
3a) Genetic markers. The remaining markers are STSs derived from the sequences that yielded SSLP markers on the Mouse Genetic Map (Dietrich, et al., Nature 380, 1996). If we successfully used the same primers as an SSLP, we denoted the physically-mapped marker by the same name (ex: D10Mit51).
3b) "Dotted" genetics. We were able to map several hundred additional markers whose original primers failed to work on the Genomatron by picking new primers from the sequence that generated the genetic marker. These new primers generally do not flank the repeat. While they ought to amplify a region within a few hundred bases of the corresponding SSLP, there is a chance that the sequenced clone was chimeric and that the new marker amplifies an entirely different region. Therefore, these markers have been given names such as D5Mit286.2 to indicate both their genetic counterparts and their distinct primers. (The .2 denotes the second set of new primers picked from the sequence containing SSLP D5Mit286.)
Q: What does a decimal designation in in a locus name mean?
A: The decimal designation means that a new primer or primer pair was chosen from the same sequence generated from the same clone as the original polymorphism. These are likely to be closely linked unless the clone is chimeric.
Q: What is the difference between singly and doubly linked contigs?
A: All the markers in doubly-linked contigs are linked to another marker in the contig by at least two YACs, while markers can be joined to a singly-linked contig by only one YAC. Thus, the doubly-linked contigs are generally smaller but more reliable.
Q: How can I obtain YACs and how much do they cost?
A: The entire library (or individual YAC clones) is available through Research Genetics, Huntsville, Alabama (phone, 800-533-4363; outside US/Canada, 256-533-4363; FAX, 256-536-9016) and Genome Systems, Inc. of St. Louis, Missouri, (phone 800-430-0030). Please contact these vendors directly for pricing information and to place orders.
Q: Where can I obtain information about mouse strains, biology, and genetics?
A: The Jackson Laboratory maintains a searchable strain index and provides information pertaining to mouse biology and genetics. Their contact information is: 600 Main Street, Bar Harbor, Maine 04609 US; 207-288-6000 Main; 207-288-6051 Public Information. We regret that we do not have polymorphism information or strain data other than what is displayed on our site and that we cannot perform specific experiments for you.
Q: Has anyone integrated the physical/genetic and cytogenetic map information?
A: The first work on this subject that we know of is reported in:
J. R. Korenberg, Chen, X-N., Devon, K. L., Noya, D., Oster-Granite, M. L. and Birren, B. W. 1999 Mouse Molecular Cytogenetic Resource: 157 BACs Link the Chromosomal and Genetic Maps. Genome Res. 9:514-523.
If you find additional cytogenetics resources that you think we should list here, we would appreciate your reporting this finding to us.
mouse-questions@genome.wi.mit.eduQ: Where can I obtain mouse physical and genetic map data?
A: We maintain a searchable on-line database where you may search for genetic markers by name, search for a YAC by its address, or look up a YAC Contig by name. Alternatively, you may download the data.
A: References to this data should be cited by listing each of the following sources:
For the genetic maps:1. Dietrich, W.F., J. Miller, R. Steen, M.A. Merchant, D. Damron-Boles, Z. Husain, R. Dredge, M.J. Daly, K.A. Ingalls, T.J. O'Conner, C.A. Evans, M.M. DeAngelis, D.M. Levinson, L. Kruglyak, N. Goodman, N.G. Copeland, N.A. Jenkins, T.L. Hawkins, L. Stein, D.C. Page, & E.S. Lander (1996) A comprehensive genetic map of the mouse genome. Nature 380:149-152.
2. Dietrich, W.F. et al. (1994) A genetic map of the mouse with 4,006 simple sequence length polymorphisms. Nature Genetics 7:220-245.
3. Copeland, N.G., D.J. Gilbert, N.A. Jenkins, J.H. Nadeau, J.T. Eppig, L.J. Maltais, J.C. Miller, W.F. Dietrich, R.G. Steen, S.E. Lincoln, A. Weaver, D.C. Joyce, M. Merchant, M. Wessel, H. Katz, L.D. Stein, M.P. Reeve, M.J. Daly, R.D. Dredge, A. Marquis, N. Goodman, E.S. Lander (1993) Genome Maps IV. Science 262:67.
For the physical maps:
4. Nusbaum, C., Slonim, D., Harris, K., Birren, B., Steen, R., Stein, L., Miller, J., Dietrich, W., Nahf, R., Wang, V., Merport, O., Castle, A., Husain, Z., Farino, G., Gray, D., Anderson, M., Devine, R., Horton, L., Ye, W., Kouyoumjian, V., Zemsteva, I., Wu, Y., Collymore, A., Courtney, D., Tam, J., Cadman, M., Haynes, A., Heuston, C., Marsland, T., Southwell, A., Trickett, P., Strivens, M., Ross, M., Makalowski, W., Xu, Y., Boguski, M., Carter, N., Denny, P., Brown, S., Hudson, T., Lander, E. A YAC-Based Physical Map of the Mouse Genome. Nature Genetics, 22(4): 388-393, August, 1999.
Additional publications with related information:
Van Etten, W., Steen, R., Nguyen, H., Castle, A., Slonim, D., Ge, B., Nusbaum, C., Schuler, G., Lander, E., Hudson, T. Radiation Hybrid Map of the Mouse Genome. Nature Genetics, 22(4):384-387, August, 1999.
Dietrich, W., J. Miller, H. Katz, D. Joyce, R. Steen, S. Lincoln, M. Daly, M.P. Reeve, A. Weaver, P. Anagnostopoulos, N. Goodman, N. Dracopoli, E.S. Lander (1992) Genetic Maps. Stephen J. O'Brien, ed. Cold Spring Harbor Laboratory Press.
Q: What should I do if I find a discrepancy between my data and yours?
A: Believe your own results. We map markers in bulk and there will be errors that we did not catch.
Q: Where can I obtain information about mouse radiation hybrid maps?
A: The WICGR mouse radiation hybrid map project has a separate site.
Q: Where can I obtain more information about the YAC libraries?
A:
1) The following reference contains details of library construction: Haldi et al. (1996). A comprehensive large-insert yeast artificial chreomosome library for physical mapping of the mouse genome. Mammalian Genome 7, 767-769.2) The following reference contains information with regard to the structure of pRML1 and 2 vectors: Spencer et al. (1993). Targeted recombination-based cloning and manipulation of large DNA segments in yeast. Methods: A companion to methods in enzymology 5, 161-175.
3) Sequence with restriction map of pRML1, from within CEN4 through vector sequence (including T3 promoter) to the EcoRI cloning site. (Obtained by Arend Sidow, Whitehead) by ddNTP-sequencing of the vector plasmid.
Notes:
a) Lower case bases 'at' at positions 158-159 reflect discrepancy between my sequence (single pass) and published CEN4 sequence. Shown here is published sequence. My sequence is 'ta' instead.b) Lower case restriction site 'ctag' at position 179 is present in my sequence but not in published CEN4 sequence. Presumably introduced during one of the 1378 cloning steps in the construction of this vector.
c) Sequence downstream of position 185 was determined twice independently using two different sequencing primers.
d) Cen4-derived sequence ends and bacterial sequence starts at position 230.
Mae III Mse I
| |
TTTTTTTCTTTTTTATAAGAATGTTACCACCTAAATAAGTTATAAAGTCAATAGTTAAGTTTGATATTTGATTGTAAAAT 80
AAAAAAAGAAAAAATATTCTTACAATGGTGGATTTATTCAATATTTCAGTTATCAATTCAAACTATAAACTAACATTTTA
o o | o o o | o o
23 55BsiY I
Sau3A I Hph I
Mbo I Hinc II Sau3A I
Dpn II Nla III Mbo I
Dpn I NspC I Dpn II
Bcl I Rma I Nsp7524 I Dpn I
Nla III Hinc II Nsp I Bcl I
| || | | || | || | |
ACCGTAATATATTTGCATGATCAAAAGGCTCAATGTTGACTAGCCAGCATGTCAACCACTATATTGATCACCGATATatG 160
TGGCATTATATAAACGTACTAGTTTTCCGAGTTACAACTGATCGGTCGTACAGTTGGTGATATAACTAGTGGCTATAtaC
o | ||o o | | || o| o || | o|
96 99 115 120 127 131 145 151Bfa I Nla III Alu I
Alu I BspH I Sau96 I Tth111II
Bfa I Mbo II Hae III Nla III Alu I
| | | | || | | | | |
GACTTCCACACCAACTAGctagTAATATGACAATAAATTCAAGATATTCTTCATGAGAATGGCCCAGCTCATGTTTGACA 240
CTGAAGGTGTGGTTGATCgatcATTATACTGTTATTTAAGTTCTATAAGAAGTACTCTTACCGGGTCGAGTACAAACTGT
o | | |o o o | o|| o| | | | |
175 179 208 212 221 226 230 240Mae II
SnaB I Mnl I
BsaA I Mse I EcoR I
|| | | |
GCTTATCATCGCTACGTAAATTAACCCTCACTAAAGGGAATTCAGA 286
CGAATAGTAGCGATGCATTTAATTGGGAGTGATTTCCCTTAAGTCT
o || o| | o | o
253 261 266 2784) Sequence with restriction map of pRML2, from within ARSH4 through vector sequence (including T7 promoter) to the EcoRI cloning site. Obtained by Arend Sidow by ddNTP-sequencing of the vector plasmid. Critical region for inverse PCR also sequenced independently by Forrest Spencer.
Note: Arsh4-derived sequence ends, and bacterial sequence starts, on position 200.
Rsa I Mse I
Csp6 I Mse I Taq I
| | | |
AAAAAGCGTACTTTACATATATATTTATTAGACAAGAAAAGCAGATTAAATAGATATACATTCGATTAACGATAAGTAAA 80
TTTTTCGCATGAAATGTATATATAAATAATCTGTTCTTTTCGTCTAATTTATCTATATGTAAGCTAATTGCTATTCATTT
| o o o o | o o | | o o
8 46 62 66Mbo II Mse I BspW I
Bbs I Xmn I Ase I Dde I Ear I
|| | || | | |
ATGTAAAATCACAGGATTTTCGTGTGTGGTCTTCTACACAGACAAGATGAAACAATTCGGCATTAATACCTGAGAGCAGG 160
TACATTTTAGTGTCCTAAAAGCACACACCAGAAGATGTGTCTGTTCTACTTTGTTAAGCCGTAATTATGGACTCTCGTCC
o o || o |o o || | ||
109 129 142 150 156 160HinP I
Hha I
BstU I
Sau3A I Hga I
Mbo I Taq I
Dpn II Sal I Sfe I
Dpn I Hinc II Ple I
Alw I Acc I BstU I Hinf I
| || | ||| | |
AAGAGCAAGATAAAAGGTAGTATTTGTTGGCGATCCCCCGATACCGTCGACGCGCGTAATACGACTCACTATAGGGCGAA 240
TTCTCGTTCTATTTTCCATCATAAACAACCGCTAGGGGGCTATGGCAGCTGCGCGCATTATGCTGAGTGATATCCCGCTT
o o o | o || |o||| o | |o o
192 206 213 223 229Taq I
Rsa I EcoR I
Csp6 I
| | |
TTGGGTACATCGAATTCAGA 260
AACCCATGTAGCTTAAGTCT
| | | o
245 250
mouse-questions@genome.wi.mit.edu
Whitehead Institute/MIT Center for Genome Research