Tetraodon nigroviridis Download

Data Version 10/31/01

Read Names

Read names indicate the sample ID and various information about the sequencing. Read names are of the form (in regular expression notation) G41P\d+[FR][A-H]\d+\.T\d. G41 is our project name for Tetraodon, P\d+ is the plate number, [FR] indicates forward or reverse read, [A-H]\d+ indicates row and column, T\d indicates terminator chemistry and attempt number (almost all 0, indicating first attempt on that clone).

Example: G41P601FC10.T0

project: G41
plate: P601
well: C10
sample or template: G41P601C10
primer: forward m13 universal primer
chemistry: terminator
paired read: G41P601RC10.* would be the opposite end read from this template

All samples are approximately 4 kb fragments generated from whole genome sheared DNA and sequenced in pOTWI.2 vector.

Note that we use the plate/well address as a unique identifier only. No clones were saved. Physical samples are NOT available.

WARNING: Due to a naming error in the generation of these reads, our internal records have a misassociation of forward and reverse reads. This HAS been fixed for this release so that the forward and reverse pairing information is consistent. HOWEVER, we do not guarantee that when we fix our internal databases we will maintain all the same names for the reads in future public releases. Therefore we recommend that users of this data not build systems dependent on being able to do incremental updates to their local copies of the data set.

Read Sequences

We have sequenced reads from the Tetraodon nigroviridis genome. Because the single file containing these read would be large, we have split the multifasta file into separate sequence files (G41_split.0001.seq.gz - G41_split.0022.seq.gz), available from our ftp site:

Tetraodon FTP site

Read Quality

We also provide sequence quality information for each read. Each read entry in the G41_split.xxxx.seq.gz file has a corresponding entry in the associated G41_split.xxxx.qual.gz file. The quality entry contains a score (1-51) for each nucleotide in the fasta file (see example below).

Tetraodon FTP site

Example

For example, the read G126P608876FB6.T0 has sequence:

>scf/ciona01/G126/seq_dir/hrs/G126P608876F.T0/G126P608876FB6.T0.seq    720      0    720  ABI
AGATGGGCGGTATGAACTCTACTCNCACTGTGGTGGNAATTCACATACAA
ATGTGGTNTTGTGNGAAGAAAAAACATCAAATCATGTTCTGGTGAAGTGG
TTAGGTACAATGTTCCTAAACCTGATGCGTTGTGGGTTTGATCCTCTCTG
TGGCTACTATGCAAAACACTGATATACAAACATATTTGGAAATAGGATAA
GATATTCGTGTTTATCCCCATGAATGGGATTTAAAAGCAAGGGACATGAA
TTAACAGGCCATCAGATTACCTCGTGCCCAGCGTCTGGTTTCAGTTGCAA
GTCGGTTGTGTATGATTGAGTGCCTTTCCTAAGGAAACAACCAACTAAAT
ACTGACCAGTCTAAACCTGCAACACTTAGGTGGAAAGGCGACGAACTAAC
CCATGGTGCTATCCGGTCAGACCAACAATACCAAACCTGATGGGTTGTGG
GGTCAATCCCCTTTGTGACCACTATGCAAAACACTGATATACAAACACAT
GATTGAAAACGCAGTTTCTTATTTCACCTCTATGTCCTGTGTTACAAAAC
ACTGATATACGAACACAATTGAAAACGCAGTTTCTTATTTCACCTCTATG
TCCTGTGTTACAAAACACTGATATACGAACACAATTGAAAACGCAGTTTC
TTATTTCACCTCTATGTCCTGTGTTGTAAAGGTTGGCGCAATCATAACCG
GGTTTGTGCCAGAAATGACG

and quality information:

>scf/ciona01/G126/qual_dir/hrs/G126P608876F.T0/G126P608876FB6.T0.qual    720      0    720  ABI
6 6 6 6 6 6 4 6 8 8 8 8 9 7 6 8 6 6 8 4 4 4 6 4 4 
4 12 15 18 15 33 34 39 23 22 4 4 4 11 8 8 10 10 12 
12 13 13 17 17 17 17 17 17 18 18 18 4 4 4 17 21 14 
4 4 4 14 15 17 12 17 23 31 33 36 26 26 26 33 20 20 
20 20 20 20 26 26 33 33 33 33 33 35 37 24 24 24 24 
30 30 45 45 49 49 49 45 45 45 45 49 49 49 42 42 40 
40 40 40 33 33 33 33 28 20 20 20 20 20 23 45 45 45 
45 45 45 45 45 49 49 40 40 40 42 42 40 37 37 40 40 
40 40 45 45 45 45 42 42 42 42 45 45 49 45 45 33 33 
33 33 33 29 29 29 29 29 29 33 45 42 40 40 40 40 40 
40 40 40 40 40 49 49 40 40 40 49 35 29 29 29 29 29 
29 29 28 29 29 33 42 42 45 45 45 43 38 35 35 35 35 
35 35 39 35 35 35 35 35 35 35 35 35 35 35 35 39 51 
42 40 40 40 40 40 40 35 33 33 35 35 35 39 40 40 42 
42 45 45 45 45 45 40 35 35 35 35 33 32 26 26 26 26 
26 35 45 45 45 43 45 45 45 45 45 45 41 51 45 43 51 
51 51 51 51 51 45 45 45 45 45 45 51 51 51 51 41 51 
51 51 51 51 45 45 45 45 45 45 45 43 40 39 39 39 39 
39 45 41 45 51 51 51 51 51 51 51 42 39 33 33 33 33 
39 40 45 39 39 42 39 39 39 42 39 38 38 38 38 40 40 
45 45 39 39 40 39 39 39 41 45 40 42 40 40 39 39 41 
51 51 51 45 45 45 40 40 37 37 30 37 41 51 40 38 38 
40 37 37 41 45 37 38 37 42 37 38 43 45 45 45 45 45 
51 45 37 51 37 45 41 41 41 45 45 45 37 37 37 33 33 
17 25 25 29 29 30 34 41 43 37 37 37 37 37 37 37 37 
35 35 35 35 34 42 37 37 37 32 32 37 45 45 34 34 34 
34 34 34 45 45 45 45 45 45 45 41 34 34 23 27 25 22 
22 29 38 38 45 38 38 37 42 42 37 37 37 34 27 27 18 
18 18 32 32 37 37 40 37 37 37 37 37 37 37 37 37 37 
44 44 45 45 27 24 24 27 24 45 37 40 40 40 37 37 33 
34 35 33 33 33 33 33 33 36 34 34 26 24 20 15 24 24 
26 29 29 29 34 31 31 33 33 33 33 36 36 36 32 32 24 
24 20 34 15 12 7 10 12 15 18 28 28 31 31 31 36 34 
32 32 19 14 14 11 11 28 28 38 23 26 30 28 22 20 24 
11 11 18 23 18 22 22 25 22 24 19 17 13 23 19 20 16 
14 14 21 21 19 24 29 27 21 21 17 20 12 12 10 18 18 
21 9 9 10 25 18 22 22 22 22 23 24 21 18 10 15 17 13 
16 12 19 19 31 32 32 18 14 15 13 8 8 16 19 26 17 17 
17 17 17 20 23 17 14 10 9 15 12 13 13 8 8 7 8 9 15 
8 9 9 9 10 10 9 12 9 9 10 11 16 8 11 6 6 6 6 8 8 10 
8 7 8 7 11 7 6 12 6 6 6 6 7 12 14 10 10 9 7